Individual-group diagnostic, all groups
Listing groups by interaction signature
Group 129 is from IL_46435.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46435.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-L-L-L-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAUGGUCCCAG*CG (   1) MLPS  -9.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-L-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00       CAGGUCCGCAG*CG (   1) MLPS  -9.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-L-L-L-L-cWW

Model IL_46435.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-L-L-L-L-L-L-L-L-cWW <-- correct model

Group 191 is from IL_71942.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_71942.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGGAGCGG*UG (   1) MLPS  -6.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-L-cWW

Model IL_71942.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-L-L-L-cWW <-- correct model

Group 197 is from IL_75415.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_75415.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGAAACCC*GC (   1) MLPS  -7.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-L-cWW

Model IL_75415.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-L-L-L-cWW <-- correct model

Group 106 is from IL_39526.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39526.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           GAACUAC*GC (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-cWW
Better:   0 Equal:   1 Score 0.50           GAACUAC*GC (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-cWW
Better:   0 Equal:   1 Score 0.50           GAACUAC*GC (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-cWW
Better:   0 Equal:   1 Score 0.50           GAACUAC*GC (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-cWW

Model IL_39526.4 was the best-scoring model for    4 sequences (100.0%) cWW-L-L-L-L-L-cWW <-- correct model

Group   5 is from IL_02835.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02835.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-L-L-L-L-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAGUGAAAG*CGAG (   1) MLPS -10.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-tHH-tHS-cWW

Model IL_02835.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-L-L-tHH-tHS-cWW <-- correct model

Group  75 is from IL_27668.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_27668.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-L-L-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGGGAUGUG*CGG (   1) MLPS  -8.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-L-tHS-cWW

Model IL_27668.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-L-L-tHS-cWW <-- correct model

Group 248 is from IL_91089.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91089.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAAAAC*GC (   1) MLPS  -4.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-L-cWW

Model IL_91089.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-L-cWW <-- correct model

Group  62 is from IL_24546.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24546.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-L-L-cSH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGCCCAAA*UG (   1) MLPS  -6.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          UCCCCAAG*CA (   1) MLPS  -6.84 deficit   0.24 prct   0.00 CutScore  98.24;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          CCCCCAAG*CG (   1) MLPS  -6.85 deficit   0.26 prct   0.00 CutScore  98.15;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          CGGCCAAC*GG (   1) MLPS  -6.98 deficit   0.39 prct   0.00 CutScore  97.20;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          UCCCAAAG*CA (   1) MLPS  -7.25 deficit   0.65 prct   0.00 CutScore  95.30;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          UCCCUAAA*UA (   1) MLPS  -7.78 deficit   1.18 prct   0.00 CutScore  91.47;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          CGGCUAAC*GG (   1) MLPS  -7.81 deficit   1.21 prct   0.00 CutScore  91.24;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          UGCCGGAA*UA (   1) MLPS  -8.13 deficit   1.54 prct   0.00 CutScore  88.93;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          AGGGCAAG*CU (   1) MLPS  -8.16 deficit   1.56 prct   0.00 CutScore  88.74;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00          AGGGCAAG*CU (   1) MLPS  -8.16 deficit   1.56 prct   0.00 CutScore  88.74;  Ed  0, 0 matches the original group, cWW-L-L-L-cSH-L-cWW

Model IL_24546.4 was the best-scoring model for   10 sequences (100.0%) cWW-L-L-L-cSH-L-cWW <-- correct model

Group  25 is from IL_09491.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09491.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAACG*UUG (   1) MLPS  -5.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW

Model IL_09491.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-cWW <-- correct model

Group  30 is from IL_11751.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11751.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGGAG*UC (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00             GGGAG*UC (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW

Model IL_11751.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-L-L-cWW <-- correct model

Group 272 is from IL_98421.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98421.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UGACC*GG (   1) MLPS  -4.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00             UGGCC*GG (   1) MLPS  -5.24 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00             CCAAU*AG (   1) MLPS  -6.83 deficit   2.11 prct   0.00 CutScore  77.81;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW

Model IL_98421.4 was the best-scoring model for    3 sequences (100.0%) cWW-L-L-L-cWW <-- correct model

Group  89 is from IL_31707.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31707.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-L-cWW-L-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGCAUAAC*GCG (   1) MLPS  -5.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW-L-bif-cWW
Better:   0 Equal:   0 Score 1.00         CGCAUAAC*GCG (   1) MLPS  -5.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW-L-bif-cWW

Model IL_31707.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-L-L-cWW-L-bif-cWW <-- correct model

Group 276 is from IL_98924.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98924.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-L-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGUAUC*GAAG (   1) MLPS  -6.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-cWW-cWW

Model IL_98924.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-cWW-cWW <-- correct model

Group 124 is from IL_45262.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_45262.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-L-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GAGCAAC*GGC (   1) MLPS  -7.01 deficit   2.82 prct   0.00 CutScore  80.47;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW

Model IL_45262.4 was the best-scoring model for    4 sequences (100.0%) cWW-L-L-L-tHS-cWW <-- correct model

Group  98 is from IL_37197.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37197.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-L-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AAUAAUG*CUAU (   1) MLPS  -6.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00         AACAAUG*CUAU (   1) MLPS  -6.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tHS-cWW-cWW

Model IL_37197.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-L-L-tHS-cWW-cWW <-- correct model

Group  10 is from IL_05513.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05513.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-L-L-tWH-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50        CCGAAGCGAG*UG (   1) MLPS  -7.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tWH-L-L-L-cWW

Model IL_05513.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-tWH-L-L-L-cWW <-- correct model

Group 201 is from IL_77014.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77014.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-L-tWH-cSH-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAACUAC*GCC (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-L-tWH-cSH-L-cWW-cWW

Model IL_77014.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-L-tWH-cSH-L-cWW-cWW <-- correct model

Group 187 is from IL_70237.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70237.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-L-cWS-tSW-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AUCCC*GAACU (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UUCCC*GAACA (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -4.52 deficit   0.39 prct   0.00 CutScore  97.17;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -4.52 deficit   0.39 prct   0.00 CutScore  97.17;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UACCC*GAACA (   1) MLPS  -5.17 deficit   1.04 prct   0.00 CutScore  92.48;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UUCCC*GAUCA (   1) MLPS  -5.66 deficit   1.53 prct   0.00 CutScore  88.87;  Ed  0, 0 matches the original group, cWW-L-L-cWS-tSW-R-R-cWW

Model IL_70237.3 was the best-scoring model for    6 sequences (100.0%) cWW-L-L-cWS-tSW-R-R-cWW <-- correct model

Group  59 is from IL_23448.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23448.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGAC*GG (   1) MLPS  -3.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW

Model IL_23448.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-cWW <-- correct model

Group 165 is from IL_58291.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58291.4
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              GGUU*AC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   1 Score 0.50              GGUU*AC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   1 Score 0.50              GGUU*AC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   1 Score 0.50              GGUU*AC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   1 Score 0.50              GGUU*AC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00              CAUU*AG (   1) MLPS  -4.00 deficit   1.14 prct   0.00 CutScore  88.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00              CAUU*AG (   1) MLPS  -4.00 deficit   1.14 prct   0.00 CutScore  88.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00              UGUU*AG (   1) MLPS  -4.13 deficit   1.28 prct   0.00 CutScore  86.56;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00              CUUC*GG (   1) MLPS  -5.76 deficit   2.90 prct   0.00 CutScore  69.44;  Ed  0, 0 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   1 Score 0.50              CGAA*UG (   1) MLPS  -6.23 deficit   3.37 prct   0.00 CutScore  64.50;  Ed  0, 0 matches the original group, cWW-L-L-cWW

Model IL_58291.4 was the best-scoring model for   10 sequences (100.0%) cWW-L-L-cWW <-- correct model

Group 181 is from IL_68767.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68767.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GUCC*GC (   1) MLPS  -3.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW

Model IL_68767.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-cWW <-- correct model

Group 224 is from IL_85510.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85510.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AAGUACG*CAGU (   1) MLPS  -8.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-cWW

Model IL_85510.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-cWW <-- correct model

Group 257 is from IL_94403.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94403.5
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-tWH-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GCGUAGGAUAG*CC (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWH-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00       GCGUAGGAUAG*CC (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWH-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00       GCGUAGGAUAG*CC (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWH-L-L-L-cWW
Better:   0 Equal:   1 Score 0.50        CCGAAGCGAG*UG (   1) MLPS -10.75 deficit   3.90 prct   0.00 CutScore  80.12;  Ed  0, 0 matches the original group, cWW-L-L-tWH-L-L-L-cWW

Model IL_94403.5 was the best-scoring model for    4 sequences (100.0%) cWW-L-L-tWH-L-L-L-cWW <-- correct model

Group 161 is from IL_57285.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57285.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-L-tWW-L-L-L-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AAAAGCAUAG*CCU (   1) MLPS  -7.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWW-L-L-L-cWS-cWW

Model IL_57285.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-L-tWW-L-L-L-cWS-cWW <-- correct model

Group 189 is from IL_70401.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70401.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-L-tWW-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAAAGAGUG*CA (   1) MLPS  -5.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWW-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00         UAAAGAGUG*CA (   1) MLPS  -5.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-L-tWW-L-L-L-cWW

Model IL_70401.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-L-tWW-L-L-L-cWW <-- correct model

Group 228 is from IL_86336.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86336.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAUUAAG*CGC (   1) MLPS  -6.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-L-L-cWW

Model IL_86336.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-L-L-L-cWW <-- correct model

Group   2 is from IL_01080.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_01080.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -6.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   1 Score 0.50             UAAC*GAG (   1) MLPS  -7.07 deficit   0.46 prct   0.00 CutScore  95.12;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           UACAAG*CGA (   1) MLPS  -8.30 deficit   1.69 prct   0.00 CutScore  82.20;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   1 Score 0.50           UACCAG*CAA (   1) MLPS  -8.30 deficit   1.69 prct   0.00 CutScore  82.20;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW

Model IL_01080.1 was the best-scoring model for    4 sequences (100.0%) cWW-L-R-L-cWW <-- correct model

Group  15 is from IL_06211.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06211.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CCUAAG*UAG (   1) MLPS  -5.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CCUAAC*GGG (   1) MLPS  -6.24 deficit   0.29 prct   0.00 CutScore  97.78;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00          UAUUAAC*GAA (   1) MLPS  -9.39 deficit   3.44 prct   0.00 CutScore  73.59;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW

Model IL_06211.3 was the best-scoring model for    3 sequences (100.0%) cWW-L-R-L-cWW <-- correct model

Group 112 is from IL_41139.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41139.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            ACAAG*CGU (   1) MLPS  -5.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW

Model IL_41139.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-L-cWW <-- correct model

Group 176 is from IL_64589.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64589.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GUACU*AUC (   1) MLPS  -5.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-cWW

Model IL_64589.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-L-cWW <-- correct model

Group 260 is from IL_94973.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94973.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-L-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAUAGUAC*GGAAGG (   1) MLPS  -7.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-tHH-cSH-tWH-tHS-cWW

Model IL_94973.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-L-tHH-cSH-tWH-tHS-cWW <-- correct model

Group 171 is from IL_61730.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61730.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-tHW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGGAACC*GUGC (   1) MLPS  -5.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-L-tHW-L-L-cWW

Model IL_61730.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-L-tHW-L-L-cWW <-- correct model

Group 179 is from IL_66744.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_66744.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-R-L-L-L-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGAAAUCC*GAACUG (   1) MLPS  -9.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-L-L-cWW-cWW

Model IL_66744.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-L-L-L-cWW-cWW <-- correct model

Group 117 is from IL_42891.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42891.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-R-L-L-L-cSH-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50    CGAAAUUCCUUG*CCUG (   1) MLPS  -9.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-L-cSH-L-L-cWW

Model IL_42891.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-L-L-cSH-L-L-cWW <-- correct model

Group 132 is from IL_46990.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46990.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAUUCC*GGUUG (   1) MLPS -11.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00      CUCAUCAG*CUGAAG (   1) MLPS -14.55 deficit   3.01 prct   0.00 CutScore  80.77;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-L-cWW

Model IL_46990.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-R-R-L-L-L-cWW <-- correct model

Group 250 is from IL_91904.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91904.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-R-L-L-cSS-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   UACGAAUAAG*CGCUGAA (   1) MLPS -11.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-cSS-L-cWW-cWW

Model IL_91904.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-L-cSS-L-cWW-cWW <-- correct model

Group 149 is from IL_52958.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52958.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-R-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AAUUC*GUUAU (   1) MLPS  -6.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-cWW

Model IL_52958.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-L-cWW <-- correct model

Group  64 is from IL_25082.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25082.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-L-R-R-L-L-tSH-tSS-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  AUAAGGAUUG*CUUGAUUU (   1) MLPS  -9.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-L-tSH-tSS-cWW-cWW-cWW

Model IL_25082.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-L-tSH-tSS-cWW-cWW-cWW <-- correct model

Group 150 is from IL_53323.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53323.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUUUG*CAUAC (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-L-cWW-cWW

Model IL_53323.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-L-cWW-cWW <-- correct model

Group 196 is from IL_75328.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_75328.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-R-R-L-L-cSS-tSS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAAGCAG*CGGGUUG (   1) MLPS -11.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-L-L-cSS-tSS-cWW

Model IL_75328.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-L-L-cSS-tSS-cWW <-- correct model

Group 145 is from IL_52173.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52173.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-R-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAAG*CAAGC (   1) MLPS  -6.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-L-cWW
Better:   0 Equal:   0 Score 1.00           UAAG*CAGUA (   1) MLPS  -7.59 deficit   1.04 prct   0.00 CutScore  90.83;  Ed  0, 0 matches the original group, cWW-L-R-R-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CGCC*GGAGG (   1) MLPS  -8.13 deficit   1.58 prct   0.00 CutScore  86.10;  Ed  0, 0 matches the original group, cWW-L-R-R-R-L-cWW

Model IL_52173.1 was the best-scoring model for    3 sequences (100.0%) cWW-L-R-R-R-L-cWW <-- correct model

Group 249 is from IL_91379.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91379.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-R-R-R-R-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAGC*GGCCGUGC (   1) MLPS  -8.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-R-R-R-L-cWW

Model IL_91379.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-R-R-R-L-cWW <-- correct model

Group  16 is from IL_06306.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06306.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-R-R-R-R-R-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UUGGC*GAUUUCCAA (   1) MLPS  -8.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-R-R-R-R-L-cWW

Model IL_06306.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-R-R-R-R-L-cWW <-- correct model

Group 212 is from IL_80505.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80505.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-R-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GAC*GAGUACUC (   1) MLPS  -7.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-R-R-R-cWW

Model IL_80505.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-R-R-R-cWW <-- correct model

Group 232 is from IL_87394.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87394.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GCG*CACAUGC (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-R-R-cWW

Model IL_87394.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-R-R-cWW <-- correct model

Group  58 is from IL_23414.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23414.1
This group is considered to be structured ***************************
Number of NTs: 21  Signature: cWW-L-R-R-R-cSH-R-bif-tWH-R-R-R-R-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAAA*UUAGUAGUGCAACCGAC (   1) MLPS -10.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cSH-R-bif-tWH-R-R-R-R-R-L-cWW
Better:   0 Equal:   0 Score 1.00 GAAA*UUAGUAGUGCAACCGAC (   1) MLPS -10.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cSH-R-bif-tWH-R-R-R-R-R-L-cWW

Model IL_23414.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-R-R-R-cSH-R-bif-tWH-R-R-R-R-R-L-cWW <-- correct model

Group  49 is from IL_21077.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21077.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50          CGA*UCUUUGG (   1) MLPS  -7.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cWW

Model IL_21077.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-cWW <-- correct model

Group 205 is from IL_78513.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_78513.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AGAG*CAAGUU (   1) MLPS  -7.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cWW

Model IL_78513.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-cWW <-- correct model

Group 226 is from IL_85805.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85805.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUUG*CACUC (   1) MLPS  -6.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cWW

Model IL_85805.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-R-cWW <-- correct model

Group 273 is from IL_98566.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98566.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAG*CGAUG (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00          GUGAG*CUACC (   1) MLPS  -8.61 deficit   1.96 prct   0.00 CutScore  81.95;  Ed  0, 0 matches the original group, cWW-L-R-R-R-cWW

Model IL_98566.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-R-R-R-cWW <-- correct model

Group  53 is from IL_21495.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21495.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-R-R-tHW-tHW-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UUAAAUC*GGACAAAG (   1) MLPS  -7.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-tHW-tHW-bif-cWW
Better:   0 Equal:   0 Score 1.00     UUAAAUC*GGACAAAG (   1) MLPS  -7.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-R-tHW-tHW-bif-cWW

Model IL_21495.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-R-R-R-tHW-tHW-bif-cWW <-- correct model

Group  86 is from IL_31224.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31224.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50          CGA*UCUUUGG (   1) MLPS  -7.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW

Model IL_31224.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-cWW <-- correct model

Group 127 is from IL_46301.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46301.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGUG*CUAAC (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAUG*CUACC (   1) MLPS  -6.23 deficit   0.25 prct   0.00 CutScore  97.88;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GGAG*CCGAGC (   1) MLPS  -6.67 deficit   0.69 prct   0.00 CutScore  94.16;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GGAG*CCGAGC (   1) MLPS  -6.67 deficit   0.69 prct   0.00 CutScore  94.16;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GGAG*CCGAGC (   1) MLPS  -6.67 deficit   0.69 prct   0.00 CutScore  94.16;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAUG*CUGCC (   1) MLPS  -7.70 deficit   1.72 prct   0.00 CutScore  85.48;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -9.73 deficit   3.76 prct   0.00 CutScore  68.25;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW

Model IL_46301.1 was the best-scoring model for    7 sequences (100.0%) cWW-L-R-R-cWW-cWW <-- correct model

Group 128 is from IL_46306.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46306.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUGGC*GAAUC (   1) MLPS  -6.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-cWW-cWW

Model IL_46306.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-cWW-cWW <-- correct model

Group  29 is from IL_11302.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11302.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-R-tHW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAAGG*UUGAC (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-tHW-L-cWW

Model IL_11302.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-tHW-L-cWW <-- correct model

Group 175 is from IL_63952.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63952.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-R-tHW-tHW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GAAACC*GACUGAC (   1) MLPS  -7.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-R-tHW-tHW-L-R-cWW

Model IL_63952.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-R-tHW-tHW-L-R-cWW <-- correct model

Group  13 is from IL_06177.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06177.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              UGA*UGA (   1) MLPS  -4.40 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW

Model IL_06177.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-cWW <-- correct model

Group 120 is from IL_43877.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43877.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UGU*AGA (   1) MLPS  -6.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00           CUG*UCUAAG (   1) MLPS  -8.50 deficit   2.24 prct   0.00 CutScore  76.45;  Ed  0, 0 matches the original group, cWW-L-R-cWW

Model IL_43877.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-R-cWW <-- correct model

Group 136 is from IL_47732.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47732.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           ACGA*UCUAU (   1) MLPS  -6.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW

Model IL_47732.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-cWW <-- correct model

Group 186 is from IL_70173.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70173.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAG*CAC (   1) MLPS  -5.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CAC (   1) MLPS  -5.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00              UAG*CAG (   1) MLPS  -6.11 deficit   0.80 prct   0.00 CutScore  91.53;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -7.61 deficit   2.30 prct   0.00 CutScore  75.78;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00          CUGU*AGUCGG (   1) MLPS -11.83 deficit   6.52 prct   0.00 CutScore  31.35;  Ed  0, 0 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00          CUGU*AGUCGG (   1) MLPS -11.83 deficit   6.52 prct   0.00 CutScore  31.35;  Ed  0, 0 matches the original group, cWW-L-R-cWW

Model IL_70173.1 was the best-scoring model for    6 sequences (100.0%) cWW-L-R-cWW <-- correct model

Group   6 is from IL_02897.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02897.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-cWW-L-L-tSW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CGUAGUACCUUG*CUUG (   1) MLPS  -8.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW-L-L-tSW-L-cWW

Model IL_02897.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-cWW-L-L-tSW-L-cWW <-- correct model

Group 153 is from IL_54450.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54450.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGAC*GGCA (   1) MLPS  -5.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW-cWW

Model IL_54450.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-cWW-cWW <-- correct model

Group 215 is from IL_81398.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81398.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CCUUG*CUUGG (   1) MLPS  -5.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-cWW-cWW-cWW

Model IL_81398.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-cWW-cWW-cWW <-- correct model

Group  11 is from IL_05684.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05684.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -6.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tHS-cWW
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -6.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tHS-cWW
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -6.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAG*CGAUG (   1) MLPS  -6.94 deficit   0.81 prct   0.00 CutScore  93.12;  Ed  0, 0 matches the original group, cWW-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAG*UGAUG (   1) MLPS  -7.58 deficit   1.45 prct   0.00 CutScore  87.69;  Ed  0, 0 matches the original group, cWW-L-R-tHS-cWW

Model IL_05684.1 was the best-scoring model for    5 sequences (100.0%) cWW-L-R-tHS-cWW <-- correct model

Group 246 is from IL_91044.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91044.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GCAUG*CUUACC (   1) MLPS  -7.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tHW-cWW

Model IL_91044.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-tHW-cWW <-- correct model

Group 243 is from IL_90133.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90133.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-tSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGG*CGAG (   1) MLPS  -6.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW
Better:   0 Equal:   0 Score 1.00             GCU*AAAC (   1) MLPS  -7.54 deficit   1.52 prct   0.00 CutScore  84.01;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW
Better:   0 Equal:   0 Score 1.00             GUA*UAAC (   1) MLPS  -7.94 deficit   1.93 prct   0.00 CutScore  79.70;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW
Better:   0 Equal:   0 Score 1.00             ACC*GACU (   1) MLPS  -8.19 deficit   2.17 prct   0.00 CutScore  77.12;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW
Better:   0 Equal:   0 Score 1.00          UGG*UCUGUGA (   1) MLPS  -9.95 deficit   3.93 prct   0.00 CutScore  58.62;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW
Better:   0 Equal:   0 Score 1.00          UGG*UCUGUGA (   1) MLPS  -9.95 deficit   3.93 prct   0.00 CutScore  58.62;  Ed  0, 0 matches the original group, cWW-L-R-tSH-cWW

Model IL_90133.3 was the best-scoring model for    6 sequences (100.0%) cWW-L-R-tSH-cWW <-- correct model

Group  46 is from IL_17682.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17682.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-L-R-tSH-tHW-cSH-tHH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   CUGAACUU*AUCAGUAAG (   1) MLPS  -9.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tHW-cSH-tHH-tHS-cWW-cWW

Model IL_17682.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-tSH-tHW-cSH-tHH-tHS-cWW-cWW <-- correct model

Group 155 is from IL_54954.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54954.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   CUGAACUU*AUCAAUAAG (   1) MLPS  -9.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW

Model IL_54954.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW <-- correct model

Group 122 is from IL_44067.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44067.4
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-tSH-tSH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUU*AUGAAAU (   1) MLPS  -7.16 deficit   1.04 prct   0.00 CutScore  94.81;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      ACGGAUC*GUGAAAU (   1) MLPS  -8.08 deficit   1.96 prct   0.00 CutScore  90.22;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW

Model IL_44067.4 was the best-scoring model for    5 sequences (100.0%) cWW-L-R-tSH-tSH-tHS-cWW-cWW <-- correct model

Group  52 is from IL_21421.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21421.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-L-R-tSH-tSS-tSS-tWH-tSH-R-R-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GGGAG*CGCCGGUGAAAUACC (   1) MLPS -10.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tSS-tSS-tWH-tSH-R-R-R-R-R-R-cWW

Model IL_21421.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-tSH-tSS-tSS-tWH-tSH-R-R-R-R-R-R-cWW <-- correct model

Group  42 is from IL_16415.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16415.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-tSH-tWH-tHS-tSS-tSS-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GAGUAG*CGCAGAUAC (   1) MLPS -11.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tWH-tHS-tSS-tSS-R-cWW
Better:   0 Equal:   0 Score 1.00     GGGGAG*CUGUGAACC (   1) MLPS -11.99 deficit   0.80 prct   0.00 CutScore  95.98;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tWH-tHS-tSS-tSS-R-cWW
Better:   0 Equal:   0 Score 1.00     AGUCAG*CUUGGAUUU (   1) MLPS -12.97 deficit   1.79 prct   0.00 CutScore  91.06;  Ed  0, 0 matches the original group, cWW-L-R-tSH-tWH-tHS-tSS-tSS-R-cWW

Model IL_16415.2 was the best-scoring model for    3 sequences (100.0%) cWW-L-R-tSH-tWH-tHS-tSS-tSS-R-cWW <-- correct model

Group 109 is from IL_40527.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_40527.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-tSS-L-tSH-L-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    AUACGGACAG*CCGAAU (   1) MLPS -10.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-R-tSS-L-tSH-L-R-L-cWW-cWW

Model IL_40527.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-R-tSS-L-tSH-L-R-L-cWW-cWW <-- correct model

Group 275 is from IL_98655.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98655.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-cHW-L-L-tHH-tSW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50    CCAAAUGCCUCG*CGCG (   1) MLPS  -7.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cHW-L-L-tHH-tSW-L-cWW

Model IL_98655.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cHW-L-L-tHH-tSW-L-cWW <-- correct model

Group 239 is from IL_88865.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88865.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cSH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAUUUGG*CG (   1) MLPS  -6.21 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cSH-L-cWW

Model IL_88865.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cSH-L-cWW <-- correct model

Group  56 is from IL_22909.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22909.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cSH-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAG*CAGAAG (   1) MLPS  -5.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cSH-R-R-R-cWW

Model IL_22909.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cSH-R-R-R-cWW <-- correct model

Group 108 is from IL_39980.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39980.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AAUUGU*AU (   1) MLPS  -5.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cSH-cWW
Better:   0 Equal:   0 Score 1.00            AGUUGU*AU (   1) MLPS  -6.02 deficit   0.85 prct   0.00 CutScore  92.07;  Ed  0, 0 matches the original group, cWW-L-cSH-cWW
Better:   0 Equal:   0 Score 1.00            CAAUGU*AG (   1) MLPS  -6.61 deficit   1.44 prct   0.00 CutScore  86.54;  Ed  0, 0 matches the original group, cWW-L-cSH-cWW
Better:   0 Equal:   0 Score 1.00            AAGGGA*UU (   1) MLPS  -6.64 deficit   1.47 prct   0.00 CutScore  86.24;  Ed  0, 0 matches the original group, cWW-L-cSH-cWW

Model IL_39980.1 was the best-scoring model for    4 sequences (100.0%) cWW-L-cSH-cWW <-- correct model

Group 177 is from IL_65137.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65137.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-cSS-tWH-tHW-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       CAACAGC*GACAUG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cSS-tWH-tHW-L-cWW-cWW
Better:   0 Equal:   1 Score 0.50       CAACAGC*GACAUG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cSS-tWH-tHW-L-cWW-cWW

Model IL_65137.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-cSS-tWH-tHW-L-cWW-cWW <-- correct model

Group 144 is from IL_50911.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_50911.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            UGCAU*AUG (   1) MLPS  -3.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWS-cWW

Model IL_50911.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cWS-cWW <-- correct model

Group 268 is from IL_97296.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97296.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20           CGCU*AAAAG (   1) MLPS  -8.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           CGCC*GCCUG (   1) MLPS  -9.46 deficit   0.49 prct   0.00 CutScore  94.86;  Ed  0, 0 matches the original group, cWW-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00             CAUG*UGG (   1) MLPS -10.10 deficit   1.12 prct   0.00 CutScore  88.20;  Ed  0, 0 matches the original group, cWW-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           GGGG*CCGAC (   1) MLPS -10.42 deficit   1.45 prct   0.00 CutScore  84.76;  Ed  0, 0 matches the original group, cWW-L-cWS-cWW

Model IL_97296.1 was the best-scoring model for    4 sequences (100.0%) cWW-L-cWS-cWW <-- correct model

Group 159 is from IL_56465.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_56465.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               CAA*UG (   1) MLPS  -3.85 deficit   0.14 prct   0.00 CutScore  98.58;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               CAA*UG (   1) MLPS  -3.85 deficit   0.14 prct   0.00 CutScore  98.58;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               GAA*UC (   1) MLPS  -3.99 deficit   0.27 prct   0.00 CutScore  97.14;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.05 deficit   0.33 prct   0.00 CutScore  96.48;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.05 deficit   0.33 prct   0.00 CutScore  96.48;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.05 deficit   0.33 prct   0.00 CutScore  96.48;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               AAG*CU (   1) MLPS  -4.18 deficit   0.47 prct   0.00 CutScore  95.09;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               AAG*CU (   1) MLPS  -4.18 deficit   0.47 prct   0.00 CutScore  95.09;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               CUG*CG (   1) MLPS  -4.92 deficit   1.20 prct   0.00 CutScore  87.32;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               CUA*UG (   1) MLPS  -5.19 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS  -5.20 deficit   1.48 prct   0.00 CutScore  84.39;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               UUG*CA (   1) MLPS  -5.39 deficit   1.68 prct   0.00 CutScore  82.37;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               UAA*UG (   1) MLPS  -5.49 deficit   1.78 prct   0.00 CutScore  81.30;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               UAA*UG (   1) MLPS  -5.49 deficit   1.78 prct   0.00 CutScore  81.30;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               UUA*UA (   1) MLPS  -5.66 deficit   1.95 prct   0.00 CutScore  79.51;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAU*GG (   1) MLPS  -5.74 deficit   2.03 prct   0.00 CutScore  78.65;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               GGC*GC (   1) MLPS  -5.75 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               CCU*AG (   1) MLPS  -6.32 deficit   2.61 prct   0.00 CutScore  72.55;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               CCU*AG (   1) MLPS  -6.32 deficit   2.61 prct   0.00 CutScore  72.55;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50               CCU*AG (   1) MLPS  -6.32 deficit   2.61 prct   0.00 CutScore  72.55;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50             CGC*GAAG (   1) MLPS  -7.18 deficit   3.46 prct   0.00 CutScore  63.57;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50             CGC*GAAG (   1) MLPS  -7.18 deficit   3.46 prct   0.00 CutScore  63.57;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   2 Score 0.33               UUG*UA (   1) MLPS  -7.21 deficit   3.49 prct   0.00 CutScore  63.25;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              UAC*GAG (   1) MLPS  -7.32 deficit   3.61 prct   0.00 CutScore  62.02;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              GAG*UAC (   1) MLPS  -7.58 deficit   3.86 prct   0.00 CutScore  59.34;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50              AUG*CCU (   1) MLPS  -9.18 deficit   5.46 prct   0.00 CutScore  42.49;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -9.56 deficit   5.84 prct   0.00 CutScore  38.50;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -9.56 deficit   5.84 prct   0.00 CutScore  38.50;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00             GGC*GGAC (   1) MLPS -10.22 deficit   6.51 prct   0.00 CutScore  31.52;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50           CAA*UACCAG (   1) MLPS -10.93 deficit   7.21 prct   0.00 CutScore  24.05;  Ed  0, 0 matches the original group, cWW-L-cWW
Better:   0 Equal:   1 Score 0.50           CAA*UACCAG (   1) MLPS -10.93 deficit   7.21 prct   0.00 CutScore  24.05;  Ed  0, 0 matches the original group, cWW-L-cWW

Model IL_56465.4 was the best-scoring model for   47 sequences (100.0%) cWW-L-cWW <-- correct model

Group 160 is from IL_56513.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_56513.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           ACGA*UCUAU (   1) MLPS  -8.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW

Model IL_56513.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cWW <-- correct model

Group 185 is from IL_69799.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69799.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33              UAGU*AG (   1) MLPS  -4.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW

Model IL_69799.1 was the best-scoring model for    1 sequences (100.0%) cWW-L-cWW <-- correct model

Group 183 is from IL_69106.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69106.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGUA*UUUC (   1) MLPS  -6.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-cWW-cWW
Better:   0 Equal:   4 Score 0.20           CGCU*AAAAG (   1) MLPS  -7.22 deficit   0.44 prct   0.00 CutScore  95.38;  Ed  0, 0 matches the original group, cWW-L-cWW-cWW

Model IL_69106.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-cWW-cWW <-- correct model

Group 261 is from IL_95150.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95150.6
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            CGAAG*CAG (   1) MLPS  -6.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tHS-cWW
Better:   0 Equal:   2 Score 0.33            CGAAG*CAG (   1) MLPS  -6.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CGGGAG*CAG (   1) MLPS  -9.96 deficit   3.93 prct   0.00 CutScore  61.40;  Ed  0, 0 matches the original group, cWW-L-tHS-cWW

Model IL_95150.6 was the best-scoring model for    3 sequences (100.0%) cWW-L-tHS-cWW <-- correct model

Group 240 is from IL_89028.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89028.6
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-tSS-cHW-L-L-cSH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50    CGAAAUUCCUUG*CCUG (   1) MLPS  -7.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tSS-cHW-L-L-cSH-L-cWW
Better:   0 Equal:   1 Score 0.50    CGAAAUUCCUUG*CCUG (   1) MLPS  -7.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tSS-cHW-L-L-cSH-L-cWW
Better:   0 Equal:   1 Score 0.50    CCAAAUGCCUCG*CGCG (   1) MLPS  -9.42 deficit   1.52 prct   0.00 CutScore  93.17;  Ed  0, 0 matches the original group, cWW-L-tSS-cHW-L-L-cSH-L-cWW

Model IL_89028.6 was the best-scoring model for    3 sequences (100.0%) cWW-L-tSS-cHW-L-L-cSH-L-cWW <-- correct model

Group  54 is from IL_21639.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21639.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-tWH-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUA*UGGAAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tWH-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00           CUA*UGGAAG (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-L-tWH-R-R-R-cWW

Model IL_21639.1 was the best-scoring model for    2 sequences (100.0%) cWW-L-tWH-R-R-R-cWW <-- correct model

Group 204 is from IL_77296.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77296.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-R-R-R-R-R-R-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UG*CUUUCUGCCAAAG (   1) MLPS -10.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-R-R-R-R-R-R-R-cWW

Model IL_77296.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-R-R-R-R-R-R-R-cWW <-- correct model

Group 271 is from IL_97842.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97842.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-R-R-R-R-cWS-cWW-cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    UGGGGC*GUUCUUUGUA (   1) MLPS -10.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-R-cWS-cWW-cWW-L-R-cWW

Model IL_97842.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-R-cWS-cWW-cWW-L-R-cWW <-- correct model

Group 234 is from IL_87523.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87523.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-R-R-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GAG*CGAGGAAC (   1) MLPS  -8.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-R-tHS-cWW

Model IL_87523.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-R-tHS-cWW <-- correct model

Group  31 is from IL_11778.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11778.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CG*CGAUUG (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-cWW

Model IL_11778.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-cWW <-- correct model

Group  47 is from IL_18675.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_18675.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CU*AUAAG (   1) MLPS  -5.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-cWW

Model IL_18675.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-cWW <-- correct model

Group 101 is from IL_37406.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37406.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UG*CAUCAG (   1) MLPS  -6.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00           UG*CAACAAG (   1) MLPS  -7.53 deficit   1.20 prct   0.00 CutScore  88.92;  Ed  0, 0 matches the original group, cWW-R-R-R-cWW

Model IL_37406.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-R-R-cWW <-- correct model

Group  57 is from IL_23262.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23262.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-R-R-tSW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGUCCC*GAAAC (   1) MLPS  -6.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-tSW-L-cWW
Better:   0 Equal:   1 Score 0.50         GGAACC*GAAAC (   1) MLPS  -6.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-tSW-L-cWW

Model IL_23262.4 was the best-scoring model for    2 sequences (100.0%) cWW-R-R-R-tSW-L-cWW <-- correct model

Group 131 is from IL_46721.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46721.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-R-R-tSW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50         GGAACC*GAAAC (   1) MLPS  -7.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-R-tSW-L-cWW

Model IL_46721.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-R-tSW-L-cWW <-- correct model

Group 167 is from IL_58586.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58586.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UG*CACAA (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-cWW
Better:   0 Equal:   1 Score 0.50              GG*CAAC (   1) MLPS  -5.62 deficit   0.18 prct   0.00 CutScore  98.15;  Ed  0, 0 matches the original group, cWW-R-R-cWW
Better:   0 Equal:   0 Score 1.00            CU*ACCACG (   1) MLPS  -7.38 deficit   1.93 prct   0.00 CutScore  79.72;  Ed  0, 0 matches the original group, cWW-R-R-cWW

Model IL_58586.2 was the best-scoring model for    3 sequences (100.0%) cWW-R-R-cWW <-- correct model

Group 174 is from IL_63253.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63253.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UU*ACGUG (   1) MLPS  -4.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-cWW

Model IL_63253.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-cWW <-- correct model

Group  61 is from IL_24293.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24293.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-R-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAG*CGGAG (   1) MLPS  -6.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAU*AGAUGC (   1) MLPS  -7.43 deficit   0.69 prct   0.00 CutScore  93.67;  Ed  0, 0 matches the original group, cWW-R-R-cWW-cWW

Model IL_24293.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-R-cWW-cWW <-- correct model

Group 141 is from IL_49527.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49527.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-R-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AUUG*CUUGAU (   1) MLPS  -5.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-cWW-cWW-cWW

Model IL_49527.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-R-cWW-cWW-cWW <-- correct model

Group 126 is from IL_46034.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46034.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-R-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGG*CGAUUC (   1) MLPS  -4.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00           GAG*CGAUUC (   1) MLPS  -5.59 deficit   0.61 prct   0.00 CutScore  95.88;  Ed  0, 0 matches the original group, cWW-R-R-tHS-cWW

Model IL_46034.3 was the best-scoring model for    2 sequences (100.0%) cWW-R-R-tHS-cWW <-- correct model

Group 264 is from IL_96446.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96446.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-R-tWH-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GUGAC*GGAGUC (   1) MLPS  -5.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GUGAG*CGAGCC (   1) MLPS  -5.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-L-R-cWW

Model IL_96446.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-R-tWH-L-R-cWW <-- correct model

Group  77 is from IL_28572.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28572.2
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUAC (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUAC (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUUC (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUUC (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW

Model IL_28572.2 was the best-scoring model for    4 sequences (100.0%) cWW-R-R-tWH-cSW-L-R-R-L-tHS-cWW <-- correct model

Group  80 is from IL_30067.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_30067.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-bif-tHW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAG*CGAACG (   1) MLPS  -5.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-bif-tHW-tHS-cWW

Model IL_30067.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-bif-tHW-tHS-cWW <-- correct model

Group  12 is from IL_05723.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05723.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50          UGUAG*CGAAG (   1) MLPS  -5.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGUAG*CGAAU (   1) MLPS  -5.51 deficit   0.01 prct   0.00 CutScore  99.94;  Ed  0, 0 matches the original group, cWW-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   1 Score 0.50          GGUAG*CAAAC (   1) MLPS  -6.97 deficit   1.46 prct   0.00 CutScore  89.05;  Ed  0, 0 matches the original group, cWW-R-cSH-tWH-tHS-cWW

Model IL_05723.1 was the best-scoring model for    3 sequences (100.0%) cWW-R-cSH-tWH-tHS-cWW <-- correct model

Group 213 is from IL_80652.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80652.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-R-cSH-tWH-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CUGAG*CGAGAUGAG (   1) MLPS  -9.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cSH-tWH-tSH-tHS-cWW

Model IL_80652.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-cSH-tWH-tSH-tHS-cWW <-- correct model

Group  21 is from IL_06847.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06847.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-R-cSW-R-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAAG*UGAAGGAAG (   1) MLPS  -9.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cSW-R-R-tHS-cWW

Model IL_06847.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-cSW-R-R-tHS-cWW <-- correct model

Group  95 is from IL_35043.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_35043.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-cWH-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GUA*UAAUAAGC (   1) MLPS  -5.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWH-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00         GUA*UAAUAAGC (   1) MLPS  -5.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWH-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00         GUA*UAAUAAGC (   1) MLPS  -5.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWH-R-R-R-cWW

Model IL_35043.1 was the best-scoring model for    3 sequences (100.0%) cWW-R-cWH-R-R-R-cWW <-- correct model

Group  36 is from IL_13777.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13777.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -3.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW

Model IL_13777.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-cWW <-- correct model

Group  40 is from IL_16166.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16166.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               AG*UAU (   1) MLPS  -3.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   0 Score 1.00               AG*UAU (   1) MLPS  -3.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   1 Score 0.50               GG*CGC (   1) MLPS  -5.00 deficit   1.44 prct   0.00 CutScore  84.89;  Ed  0, 0 matches the original group, cWW-R-cWW

Model IL_16166.4 was the best-scoring model for    3 sequences (100.0%) cWW-R-cWW <-- correct model

Group  78 is from IL_28644.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28644.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              UG*CAAG (   1) MLPS  -4.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW

Model IL_28644.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-cWW <-- correct model

Group  85 is from IL_31066.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31066.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CCG*CAAG (   1) MLPS  -2.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   0 Score 1.00             CCG*CAAG (   1) MLPS  -2.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   0 Score 1.00             CCG*CAAG (   1) MLPS  -2.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   0 Score 1.00             CCG*CAAG (   1) MLPS  -2.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW

Model IL_31066.3 was the best-scoring model for    4 sequences (100.0%) cWW-R-cWW <-- correct model

Group 210 is from IL_80348.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80348.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UG*UUA (   1) MLPS  -3.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   2 Score 0.33              AG*UAGU (   1) MLPS  -5.13 deficit   1.44 prct   0.00 CutScore  84.82;  Ed  0, 0 matches the original group, cWW-R-cWW
Better:   0 Equal:   0 Score 1.00            UG*UUUCGA (   1) MLPS  -7.35 deficit   3.66 prct   0.00 CutScore  61.43;  Ed  0, 0 matches the original group, cWW-R-cWW

Model IL_80348.3 was the best-scoring model for    3 sequences (100.0%) cWW-R-cWW <-- correct model

Group 277 is from IL_99397.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99397.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-R-cWW-cWH-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGCCAG*CUG (   1) MLPS  -3.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-cWW-cWH-L-L-L-cWW

Model IL_99397.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-cWW-cWH-L-L-L-cWW <-- correct model

Group 105 is from IL_39355.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39355.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-R-tHH-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAAUU*ACCA (   1) MLPS  -3.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHH-L-L-cWW
Better:   0 Equal:   0 Score 1.00           UAAUU*ACCA (   1) MLPS  -3.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHH-L-L-cWW

Model IL_39355.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-tHH-L-L-cWW <-- correct model

Group  48 is from IL_20775.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_20775.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUAG*UCUA (   1) MLPS  -5.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHS-cWW

Model IL_20775.1 was the best-scoring model for    1 sequences (100.0%) cWW-R-tHS-cWW <-- correct model

Group 151 is from IL_53635.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53635.3
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-R-tHW-tHW-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GAAAC*GAGAUAGC (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAAC*GAGAUAGC (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAAC*GAGAUAGC (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAAG*CUAGUAGC (   1) MLPS  -9.61 deficit   3.11 prct   0.00 CutScore  84.17;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAAG*CUAGUAGC (   1) MLPS  -9.61 deficit   3.11 prct   0.00 CutScore  84.17;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAUC*GCAACAGC (   1) MLPS -10.12 deficit   3.62 prct   0.00 CutScore  81.59;  Ed  0, 0 matches the original group, cWW-R-tHW-tHW-tWW-cWW

Model IL_53635.3 was the best-scoring model for    6 sequences (100.0%) cWW-R-tHW-tHW-tWW-cWW <-- correct model

Group  87 is from IL_31555.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31555.5
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-R-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAAC*GAAAG (   1) MLPS  -6.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAC*GAAAG (   1) MLPS  -6.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAC*GAAAG (   1) MLPS  -6.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGAG*CAGAG (   1) MLPS  -7.28 deficit   0.33 prct   0.00 CutScore  96.50;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGAG*CAAAG (   1) MLPS  -7.47 deficit   0.52 prct   0.00 CutScore  94.51;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -7.83 deficit   0.89 prct   0.00 CutScore  90.64;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33           CACC*GCAAG (   1) MLPS  -7.83 deficit   0.89 prct   0.00 CutScore  90.64;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGAG*CAAAA (   1) MLPS  -7.86 deficit   0.91 prct   0.00 CutScore  90.38;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGAG*CGGAA (   1) MLPS  -7.89 deficit   0.95 prct   0.00 CutScore  90.02;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGAG*CGGAA (   1) MLPS  -7.89 deficit   0.95 prct   0.00 CutScore  90.02;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50           GCCC*GUAAC (   1) MLPS  -8.18 deficit   1.24 prct   0.00 CutScore  86.97;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         UAAAUA*UGAAG (   1) MLPS -13.72 deficit   6.77 prct   0.00 CutScore  28.71;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CAGG*UAUUGG (   1) MLPS -16.74 deficit   9.79 prct   0.00 CutScore  -3.05;  Ed  0, 0 matches the original group, cWW-R-tSH-tHS-cWW

Model IL_31555.5 was the best-scoring model for   13 sequences (100.0%) cWW-R-tSH-tHS-cWW <-- correct model

Group 125 is from IL_45794.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_45794.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-R-tSS-tWW-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGACGG*UGAUGACA (   1) MLPS  -7.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSS-tWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00      CGAUGG*UGUUGACG (   1) MLPS  -7.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSS-tWW-tWW-cWW

Model IL_45794.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-tSS-tWW-tWW-cWW <-- correct model

Group  33 is from IL_12211.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12211.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-R-tSW-L-cWW-bif-tSW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGUUGCCU*AUAAGC (   1) MLPS  -7.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tSW-L-cWW-bif-tSW-R-cWW
Better:   0 Equal:   0 Score 1.00       GAAAGCA*UUAAGC (   1) MLPS  -8.95 deficit   1.62 prct   0.00 CutScore  91.90;  Ed  0, 0 matches the original group, cWW-R-tSW-L-cWW-bif-tSW-R-cWW

Model IL_12211.1 was the best-scoring model for    2 sequences (100.0%) cWW-R-tSW-L-cWW-bif-tSW-R-cWW <-- correct model

Group 218 is from IL_82563.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82563.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-R-tWH-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UG*CUGAGAAA (   1) MLPS  -4.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tWH-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UG*CUGAGAAA (   1) MLPS  -4.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tWH-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UG*CUGAGAAA (   1) MLPS  -4.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tWH-R-R-R-cWW

Model IL_82563.1 was the best-scoring model for    3 sequences (100.0%) cWW-R-tWH-R-R-R-cWW <-- correct model

Group  14 is from IL_06180.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06180.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-R-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAUAAG*UGAAA (   1) MLPS  -9.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUCAG*CGAAA (   1) MLPS  -9.89 deficit   0.26 prct   0.00 CutScore  97.59;  Ed  0, 0 matches the original group, cWW-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CUAUG*UGUAUG (   1) MLPS -11.57 deficit   1.94 prct   0.00 CutScore  82.23;  Ed  0, 0 matches the original group, cWW-R-tWH-tHS-cWW

Model IL_06180.1 was the best-scoring model for    3 sequences (100.0%) cWW-R-tWH-tHS-cWW <-- correct model

Group 113 is from IL_41153.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41153.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-bif-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGUAA*UGA (   1) MLPS  -5.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-bif-L-cWW

Model IL_41153.1 was the best-scoring model for    1 sequences (100.0%) cWW-bif-L-cWW <-- correct model

Group 238 is from IL_88367.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88367.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-bif-R-cSH-tWH-tHS-L-R-tSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     AGGUAAA*UUUAAAUU (   1) MLPS  -8.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-bif-R-cSH-tWH-tHS-L-R-tSH-cWW

Model IL_88367.1 was the best-scoring model for    1 sequences (100.0%) cWW-bif-R-cSH-tWH-tHS-L-R-tSH-cWW <-- correct model

Group 230 is from IL_86981.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86981.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-bif-tSH-tHW-cSH-tHH-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CCGACCG*CCAGUACG (   1) MLPS  -6.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-bif-tSH-tHW-cSH-tHH-bif-cWW

Model IL_86981.1 was the best-scoring model for    1 sequences (100.0%) cWW-bif-tSH-tHW-cSH-tHH-bif-cWW <-- correct model

Group  23 is from IL_08926.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_08926.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -2.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHH-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -2.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHH-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -2.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHH-cWW
Better:   0 Equal:   0 Score 1.00               UG*UCG (   1) MLPS  -3.36 deficit   0.74 prct   0.00 CutScore  93.27;  Ed  0, 0 matches the original group, cWW-cHH-cWW
Better:   0 Equal:   2 Score 0.33               UG*UUG (   1) MLPS  -5.08 deficit   2.47 prct   0.00 CutScore  77.71;  Ed  0, 0 matches the original group, cWW-cHH-cWW
Better:   0 Equal:   0 Score 1.00            UG*UCUCGA (   1) MLPS -10.29 deficit   7.67 prct   0.00 CutScore  30.61;  Ed  0, 0 matches the original group, cWW-cHH-cWW

Model IL_08926.3 was the best-scoring model for    6 sequences (100.0%) cWW-cHH-cWW <-- correct model

Group 100 is from IL_37347.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37347.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cHW-L-tHW-tHW-tHW-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GGAUAAAUC*GGAAUAC (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHW-L-tHW-tHW-tHW-bif-cWW

Model IL_37347.1 was the best-scoring model for    1 sequences (100.0%) cWW-cHW-L-tHW-tHW-tHW-bif-cWW <-- correct model

Group 137 is from IL_47758.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47758.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cHW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGUAC*GGGC (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GGUAC*GGGC (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cHW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUAG*CAAC (   1) MLPS  -7.98 deficit   1.50 prct   0.00 CutScore  84.24;  Ed  0, 0 matches the original group, cWW-cHW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUG*CUGU (   1) MLPS  -8.41 deficit   1.92 prct   0.00 CutScore  79.74;  Ed  0, 0 matches the original group, cWW-cHW-cWW-cWW

Model IL_47758.2 was the best-scoring model for    4 sequences (100.0%) cWW-cHW-cWW-cWW <-- correct model

Group  91 is from IL_33842.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33842.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSH-L-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUUAC*GUUC (   1) MLPS  -3.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           GUUAC*GUUC (   1) MLPS  -3.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-L-cWS-cWW

Model IL_33842.1 was the best-scoring model for    2 sequences (100.0%) cWW-cSH-L-cWS-cWW <-- correct model

Group  22 is from IL_07300.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07300.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGGAUC*GUC (   1) MLPS  -5.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GGGAUC*GUC (   1) MLPS  -5.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CCAAUC*GGAG (   1) MLPS -11.36 deficit   6.06 prct   0.00 CutScore  57.24;  Ed  0, 0 matches the original group, cWW-cSH-L-cWW-cWW

Model IL_07300.2 was the best-scoring model for    3 sequences (100.0%) cWW-cSH-L-cWW-cWW <-- correct model

Group  27 is from IL_09587.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09587.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSH-R-R-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GUUGC*GAACUC (   1) MLPS  -9.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-R-R-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GAACUG*CACCCC (   1) MLPS -10.57 deficit   1.28 prct   0.00 CutScore  92.64;  Ed  0, 0 matches the original group, cWW-cSH-R-R-R-L-cWW-cWW

Model IL_09587.1 was the best-scoring model for    2 sequences (100.0%) cWW-cSH-R-R-R-L-cWW-cWW <-- correct model

Group 116 is from IL_42251.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42251.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UG*CUAA (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00              UG*CUAA (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            GUUG*CAUC (   1) MLPS  -5.78 deficit   0.66 prct   0.00 CutScore  93.05;  Ed  0, 0 matches the original group, cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            GUAG*CAUC (   1) MLPS  -6.63 deficit   1.51 prct   0.00 CutScore  84.13;  Ed  0, 0 matches the original group, cWW-cSH-R-cWW

Model IL_42251.1 was the best-scoring model for    4 sequences (100.0%) cWW-cSH-R-cWW <-- correct model

Group 237 is from IL_88119.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88119.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            AAUA*UUCU (   1) MLPS  -4.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-R-cWW

Model IL_88119.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSH-R-cWW <-- correct model

Group 231 is from IL_87065.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87065.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAA*UACC (   1) MLPS  -5.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00             GAA*UACC (   1) MLPS  -5.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00             ACG*CUAU (   1) MLPS  -8.31 deficit   3.04 prct   0.00 CutScore  68.03;  Ed  0, 0 matches the original group, cWW-cSH-cWW

Model IL_87065.1 was the best-scoring model for    3 sequences (100.0%) cWW-cSH-cWW <-- correct model

Group  99 is from IL_37325.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37325.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -3.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW

Model IL_37325.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSH-cWW-cWW <-- correct model

Group 158 is from IL_55938.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_55938.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGUG*CUC (   1) MLPS  -5.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGUG*CUC (   1) MLPS  -5.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   1 Score 0.50             GUUG*CUC (   1) MLPS  -5.29 deficit   0.18 prct   0.00 CutScore  98.08;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGUU*AUC (   1) MLPS  -5.37 deficit   0.26 prct   0.00 CutScore  97.23;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   1 Score 0.50            GGUUU*AUC (   1) MLPS  -6.65 deficit   1.54 prct   0.00 CutScore  83.84;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UGAUC*GUA (   1) MLPS  -6.77 deficit   1.66 prct   0.00 CutScore  82.57;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CAAC*GCG (   1) MLPS  -6.91 deficit   1.80 prct   0.00 CutScore  81.01;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUC*GUA (   1) MLPS  -6.95 deficit   1.84 prct   0.00 CutScore  80.64;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAUA*UUC (   1) MLPS  -7.60 deficit   2.49 prct   0.00 CutScore  73.75;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGCUU*GUC (   1) MLPS  -8.05 deficit   2.94 prct   0.00 CutScore  69.06;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GAGUG*CUC (   1) MLPS  -8.15 deficit   3.04 prct   0.00 CutScore  68.01;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CUCC*GAG (   1) MLPS  -8.43 deficit   3.32 prct   0.00 CutScore  65.05;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CUCC*GUG (   1) MLPS  -8.51 deficit   3.40 prct   0.00 CutScore  64.25;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUU*GUG (   1) MLPS  -8.58 deficit   3.47 prct   0.00 CutScore  63.50;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUU*GUG (   1) MLPS  -8.58 deficit   3.47 prct   0.00 CutScore  63.50;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCGAG*CAG (   1) MLPS  -9.91 deficit   4.80 prct   0.00 CutScore  49.52;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   2 Score 0.33            CGAAG*CAG (   1) MLPS -10.10 deficit   4.99 prct   0.00 CutScore  47.48;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   2 Score 0.33            CGAAG*CAG (   1) MLPS -10.10 deficit   4.99 prct   0.00 CutScore  47.48;  Ed  0, 0 matches the original group, cWW-cSH-cWW-cWW

Model IL_55938.4 was the best-scoring model for   18 sequences (100.0%) cWW-cSH-cWW-cWW <-- correct model

Group   1 is from IL_00998.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_00998.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UAG*CAAAA (   1) MLPS  -5.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UAG*CGAAA (   1) MLPS  -5.08 deficit   0.00 prct   0.00 CutScore  99.98;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW

Model IL_00998.1 was the best-scoring model for    2 sequences (100.0%) cWW-cSH-tHS-cWW <-- correct model

Group 118 is from IL_43124.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43124.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GUG*CAAC (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             GUG*CAAC (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             GUG*CAAC (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             GUG*CAAC (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             GUG*CAAC (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             AGC*GGCU (   1) MLPS  -5.39 deficit   0.73 prct   0.00 CutScore  92.33;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GAGG (   1) MLPS  -6.78 deficit   2.12 prct   0.00 CutScore  77.64;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UGC*GAUA (   1) MLPS  -7.41 deficit   2.75 prct   0.00 CutScore  71.06;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50             UAC*GCGG (   1) MLPS  -7.57 deficit   2.91 prct   0.00 CutScore  69.41;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UUC*GAGUG (   1) MLPS  -8.36 deficit   3.70 prct   0.00 CutScore  61.09;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50             CUC*GUUG (   1) MLPS  -9.16 deficit   4.50 prct   0.00 CutScore  52.59;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW

Model IL_43124.2 was the best-scoring model for   11 sequences (100.0%) cWW-cSH-tHS-cWW <-- correct model

Group 123 is from IL_44540.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44540.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UCU*AA (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.36;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CAC*GG (   1) MLPS  -3.06 deficit   0.16 prct   0.00 CutScore  98.27;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CAU*AG (   1) MLPS  -3.22 deficit   0.32 prct   0.00 CutScore  96.63;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CAU*AG (   1) MLPS  -3.22 deficit   0.32 prct   0.00 CutScore  96.63;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CAU*AG (   1) MLPS  -3.22 deficit   0.32 prct   0.00 CutScore  96.63;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CAU*AG (   1) MLPS  -3.22 deficit   0.32 prct   0.00 CutScore  96.63;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.33 deficit   1.43 prct   0.00 CutScore  84.92;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.33 deficit   1.43 prct   0.00 CutScore  84.92;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.43 deficit   1.53 prct   0.00 CutScore  83.89;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.43 deficit   1.53 prct   0.00 CutScore  83.89;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.43 deficit   1.53 prct   0.00 CutScore  83.89;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.43 deficit   1.53 prct   0.00 CutScore  83.89;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.43 deficit   1.53 prct   0.00 CutScore  83.89;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CUG*CG (   1) MLPS  -4.56 deficit   1.66 prct   0.00 CutScore  82.48;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               CUG*CG (   1) MLPS  -4.56 deficit   1.66 prct   0.00 CutScore  82.48;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UACU*AA (   1) MLPS  -4.59 deficit   1.69 prct   0.00 CutScore  82.25;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               ACG*CU (   1) MLPS  -4.84 deficit   1.94 prct   0.00 CutScore  79.59;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               GAU*AC (   1) MLPS  -4.87 deficit   1.97 prct   0.00 CutScore  79.31;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -4.91 deficit   2.01 prct   0.00 CutScore  78.82;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -4.91 deficit   2.01 prct   0.00 CutScore  78.82;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   4 Score 0.20               UAG*CG (   1) MLPS  -4.99 deficit   2.09 prct   0.00 CutScore  78.04;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   4 Score 0.20               UAG*CG (   1) MLPS  -4.99 deficit   2.09 prct   0.00 CutScore  78.04;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   2 Score 0.33               AAG*CU (   1) MLPS  -5.11 deficit   2.21 prct   0.00 CutScore  76.78;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               ACA*UU (   1) MLPS  -5.25 deficit   2.35 prct   0.00 CutScore  75.26;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00               UUU*AA (   1) MLPS  -5.65 deficit   2.75 prct   0.00 CutScore  71.00;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              UAAU*AA (   1) MLPS  -5.82 deficit   2.92 prct   0.00 CutScore  69.30;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CCU*AG (   1) MLPS  -6.12 deficit   3.22 prct   0.00 CutScore  66.11;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50               CCU*AG (   1) MLPS  -6.12 deficit   3.22 prct   0.00 CutScore  66.11;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   3 Score 0.25              GAAG*CC (   1) MLPS  -6.44 deficit   3.54 prct   0.00 CutScore  62.72;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   3 Score 0.25               GUU*AC (   1) MLPS  -7.12 deficit   4.22 prct   0.00 CutScore  55.57;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00              GACU*AC (   1) MLPS  -7.20 deficit   4.30 prct   0.00 CutScore  54.71;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UCAUC*GG (   1) MLPS -10.40 deficit   7.50 prct   0.00 CutScore  21.02;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UCAGC*GG (   1) MLPS -13.58 deficit  10.68 prct   0.00 CutScore -12.43;  Ed  0, 0 matches the original group, cWW-cSH-tHS-cWW

Model IL_44540.4 was the best-scoring model for   43 sequences (100.0%) cWW-cSH-tHS-cWW <-- correct model

Group 253 is from IL_92114.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92114.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-tHW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   1 Score 0.50           UAUG*CUAAG (   1) MLPS  -3.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW
Better:   0 Equal:   0 Score 1.00           UAUG*CUACG (   1) MLPS  -4.03 deficit   0.31 prct   0.00 CutScore  97.99;  Ed  0, 0 matches the original group, cWW-cSH-tHW-L-cWW

Model IL_92114.3 was the best-scoring model for    9 sequences (100.0%) cWW-cSH-tHW-L-cWW <-- correct model

Group 170 is from IL_60649.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_60649.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSS-L-L-L-tSS-tHW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AUAUGAGG*UAAAU (   1) MLPS  -6.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-L-L-L-tSS-tHW-L-R-cWW

Model IL_60649.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSS-L-L-L-tSS-tHW-L-R-cWW <-- correct model

Group  34 is from IL_12507.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12507.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSS-cSS-R-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       CAACAGC*GACAUG (   1) MLPS -10.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-cSS-R-R-L-L-L-cWW

Model IL_12507.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSS-cSS-R-R-L-L-L-cWW <-- correct model

Group 263 is from IL_96206.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96206.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSS-cSS-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GU*AAGC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-cSS-R-cWW
Better:   0 Equal:   0 Score 1.00              GC*GAUC (   1) MLPS  -4.30 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0 matches the original group, cWW-cSS-cSS-R-cWW

Model IL_96206.3 was the best-scoring model for    2 sequences (100.0%) cWW-cSS-cSS-R-cWW <-- correct model

Group  73 is from IL_27243.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_27243.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cSS-cWH-tSS-cWH-R-tWH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GGUG*CUGAGAAAGUC (   1) MLPS  -8.21 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-cWH-tSS-cWH-R-tWH-R-cWW

Model IL_27243.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSS-cWH-tSS-cWH-R-tWH-R-cWW <-- correct model

Group  93 is from IL_34363.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34363.2
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAUAGACAG*UCGAG (   1) MLPS  -6.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW
Better:   0 Equal:   0 Score 1.00      CCUAGACAG*CCGAG (   1) MLPS  -6.94 deficit   0.16 prct   0.00 CutScore  99.21;  Ed  0, 0 matches the original group, cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW
Better:   0 Equal:   0 Score 1.00      UCUAGACAG*CCGAA (   1) MLPS  -7.40 deficit   0.62 prct   0.00 CutScore  96.88;  Ed  0, 0 matches the original group, cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW
Better:   0 Equal:   0 Score 1.00      CCCAGACAG*UCGAG (   1) MLPS  -7.46 deficit   0.68 prct   0.00 CutScore  96.58;  Ed  0, 0 matches the original group, cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW

Model IL_34363.2 was the best-scoring model for    4 sequences (100.0%) cWW-cSS-tSS-L-tSH-tSS-tHS-L-cSS-bif-cWW <-- correct model

Group 274 is from IL_98591.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98591.3
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    UGCAAAC*GGACGUAUA (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    UGCCAAC*GGACGUAUA (   1) MLPS  -7.37 deficit   0.51 prct   0.00 CutScore  97.67;  Ed  0, 0 matches the original group, cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    UGCGAAC*GGAGGUAUA (   1) MLPS  -8.22 deficit   1.36 prct   0.00 CutScore  93.82;  Ed  0, 0 matches the original group, cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    CGCAAAU*ACUCGUACG (   1) MLPS -11.24 deficit   4.37 prct   0.00 CutScore  80.08;  Ed  0, 0 matches the original group, cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW

Model IL_98591.3 was the best-scoring model for    4 sequences (100.0%) cWW-cSS-tSS-tHH-tWW-tHH-tHS-cWW <-- correct model

Group 152 is from IL_53988.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53988.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cSW-L-L-tHS-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CCUGAAUC*GUGAG (   1) MLPS  -9.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-L-L-tHS-cWS-cWW

Model IL_53988.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSW-L-L-tHS-cWS-cWW <-- correct model

Group 110 is from IL_40845.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_40845.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSW-cSH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            GCA*UUCCC (   1) MLPS  -4.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cSH-R-cWW

Model IL_40845.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSW-cSH-R-cWW <-- correct model

Group 193 is from IL_73000.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73000.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              GU*AAAC (   1) MLPS  -4.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50              GU*AAAC (   1) MLPS  -4.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50              GG*CAGC (   1) MLPS  -5.13 deficit   0.60 prct   0.00 CutScore  93.72;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -5.20 deficit   0.67 prct   0.00 CutScore  92.99;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GC*GGAC (   1) MLPS  -5.32 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GUU*AGAAC (   1) MLPS  -8.30 deficit   3.76 prct   0.00 CutScore  60.37;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50            GCA*UUCCC (   1) MLPS  -9.85 deficit   5.32 prct   0.00 CutScore  44.02;  Ed  0, 0 matches the original group, cWW-cSW-cSH-cWW

Model IL_73000.2 was the best-scoring model for    7 sequences (100.0%) cWW-cSW-cSH-cWW <-- correct model

Group  44 is from IL_17212.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17212.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              AUA*UGU (   1) MLPS  -4.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00              UUU*AGA (   1) MLPS  -4.99 deficit   0.14 prct   0.00 CutScore  98.56;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50             AGUG*CGU (   1) MLPS  -5.31 deficit   0.46 prct   0.00 CutScore  95.15;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50             AGUG*CGU (   1) MLPS  -5.31 deficit   0.46 prct   0.00 CutScore  95.15;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50             AGUG*CGU (   1) MLPS  -5.31 deficit   0.46 prct   0.00 CutScore  95.15;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50             AGUG*CGU (   1) MLPS  -5.31 deficit   0.46 prct   0.00 CutScore  95.15;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00             GACG*CGC (   1) MLPS  -6.72 deficit   1.88 prct   0.00 CutScore  80.26;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   2 Score 0.33              GCC*GCC (   1) MLPS  -7.32 deficit   2.47 prct   0.00 CutScore  73.97;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              UUA*UUA (   1) MLPS  -7.39 deficit   2.54 prct   0.00 CutScore  73.25;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00            UCGAC*GGA (   1) MLPS  -9.28 deficit   4.43 prct   0.00 CutScore  53.39;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GGAG (   1) MLPS -10.33 deficit   5.48 prct   0.00 CutScore  42.32;  Ed  0, 0 matches the original group, cWW-cSW-cWW

Model IL_17212.2 was the best-scoring model for   11 sequences (100.0%) cWW-cSW-cWW <-- correct model

Group 251 is from IL_92027.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92027.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -3.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              AC*GAAU (   1) MLPS  -3.69 deficit   0.29 prct   0.00 CutScore  97.00;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              UC*GAAA (   1) MLPS  -3.74 deficit   0.33 prct   0.00 CutScore  96.49;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              CG*CAAG (   1) MLPS  -3.94 deficit   0.53 prct   0.00 CutScore  94.42;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              CG*CAAG (   1) MLPS  -3.94 deficit   0.53 prct   0.00 CutScore  94.42;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              GU*AAAC (   1) MLPS  -4.01 deficit   0.60 prct   0.00 CutScore  93.63;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00              AC*GUAU (   1) MLPS  -4.17 deficit   0.77 prct   0.00 CutScore  91.92;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00              GU*AUAC (   1) MLPS  -4.49 deficit   1.09 prct   0.00 CutScore  88.56;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00              GU*AUAC (   1) MLPS  -4.49 deficit   1.09 prct   0.00 CutScore  88.56;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00              GU*AUAC (   1) MLPS  -4.49 deficit   1.09 prct   0.00 CutScore  88.56;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              CG*CCAG (   1) MLPS  -4.90 deficit   1.49 prct   0.00 CutScore  84.30;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50              GG*CAGC (   1) MLPS  -6.53 deficit   3.12 prct   0.00 CutScore  67.12;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00             CC*GAAAG (   1) MLPS  -6.95 deficit   3.54 prct   0.00 CutScore  62.73;  Ed  0, 0 matches the original group, cWW-cSW-cWW
Better:   0 Equal:   1 Score 0.50           GC*GAACUAC (   1) MLPS  -9.84 deficit   6.43 prct   0.00 CutScore  32.32;  Ed  0, 0 matches the original group, cWW-cSW-cWW

Model IL_92027.3 was the best-scoring model for   17 sequences (100.0%) cWW-cSW-cWW <-- correct model

Group 163 is from IL_57785.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57785.5
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cSW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20           AAAAG*CGCU (   1) MLPS  -5.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tHS-cWW
Better:   0 Equal:   4 Score 0.20           AAAAG*CGCU (   1) MLPS  -5.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tHS-cWW

Model IL_57785.5 was the best-scoring model for    2 sequences (100.0%) cWW-cSW-tHS-cWW <-- correct model

Group  90 is from IL_31754.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31754.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cSW-tHW-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       CUAGUAC*GGACCG (   1) MLPS  -5.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tHW-cSH-tWH-tHS-cWW

Model IL_31754.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSW-tHW-cSH-tWH-tHS-cWW <-- correct model

Group 270 is from IL_97833.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97833.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cSW-tSH-tWH-tHW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GCCAGGC*GAGCAAC (   1) MLPS  -6.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tSH-tWH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GCCAGGC*GAGCAAC (   1) MLPS  -6.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tSH-tWH-tHW-tHS-cWW-cWW

Model IL_97833.1 was the best-scoring model for    2 sequences (100.0%) cWW-cSW-tSH-tWH-tHW-tHS-cWW-cWW <-- correct model

Group  19 is from IL_06471.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06471.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cSW-tWH-tSW-cSH-L-cWS-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUCAAC*GGAC (   1) MLPS  -3.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cSW-tWH-tSW-cSH-L-cWS-R-cWW

Model IL_06471.1 was the best-scoring model for    1 sequences (100.0%) cWW-cSW-tWH-tSW-cSH-L-cWS-R-cWW <-- correct model

Group  26 is from IL_09530.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09530.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWH-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAUC*GCGUA (   1) MLPS  -7.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWH-L-R-cWW
Better:   0 Equal:   0 Score 1.00          UGAUC*GCGUA (   1) MLPS  -7.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWH-L-R-cWW
Better:   0 Equal:   0 Score 1.00          UGAAC*GCGCA (   1) MLPS  -7.55 deficit   0.51 prct   0.00 CutScore  96.36;  Ed  0, 0 matches the original group, cWW-cWH-L-R-cWW
Better:   0 Equal:   0 Score 1.00    AUGAUUAGCGAC*GGAU (   1) MLPS -22.11 deficit  15.07 prct   0.00 CutScore  -7.25;  Ed  0, 0 matches the original group, cWW-cWH-L-R-cWW

Model IL_09530.1 was the best-scoring model for    4 sequences (100.0%) cWW-cWH-L-R-cWW <-- correct model

Group 217 is from IL_82444.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82444.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CGA*UGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGA*UGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -4.10 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              UGA*UGA (   1) MLPS  -4.31 deficit   0.21 prct   0.00 CutScore  97.75;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              UGA*UGA (   1) MLPS  -4.31 deficit   0.21 prct   0.00 CutScore  97.75;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              UGA*UGA (   1) MLPS  -4.31 deficit   0.21 prct   0.00 CutScore  97.75;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              AGC*GGU (   1) MLPS  -4.52 deficit   0.42 prct   0.00 CutScore  95.58;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CGC (   1) MLPS  -4.52 deficit   0.42 prct   0.00 CutScore  95.54;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              CCA*UGG (   1) MLPS  -4.76 deficit   0.66 prct   0.00 CutScore  93.00;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              UAC*GGA (   1) MLPS  -5.57 deficit   1.47 prct   0.00 CutScore  84.54;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              UAC*GGA (   1) MLPS  -5.57 deficit   1.47 prct   0.00 CutScore  84.54;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              AAU*AGU (   1) MLPS  -5.61 deficit   1.51 prct   0.00 CutScore  84.09;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              AAU*AGU (   1) MLPS  -5.61 deficit   1.51 prct   0.00 CutScore  84.09;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              CAG*CAG (   1) MLPS  -6.64 deficit   2.54 prct   0.00 CutScore  73.29;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              AAG*CAU (   1) MLPS  -6.94 deficit   2.84 prct   0.00 CutScore  70.14;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -7.03 deficit   2.93 prct   0.00 CutScore  69.20;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   1 Score 0.50              UAU*ACA (   1) MLPS  -7.33 deficit   3.23 prct   0.00 CutScore  66.02;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00             AGC*GGGU (   1) MLPS  -8.15 deficit   4.05 prct   0.00 CutScore  57.41;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00              UUG*UUG (   1) MLPS  -9.72 deficit   5.62 prct   0.00 CutScore  40.80;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00             UAA*UCGA (   1) MLPS -10.52 deficit   6.42 prct   0.00 CutScore  32.38;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   5 Score 0.17             CAC*GAAG (   1) MLPS -10.74 deficit   6.64 prct   0.00 CutScore  30.14;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00            GGA*UUUUC (   1) MLPS -12.92 deficit   8.82 prct   0.00 CutScore   7.12;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00          CUGU*ACUCUG (   1) MLPS -15.12 deficit  11.02 prct   0.00 CutScore -15.96;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00          CUGU*AUUCGG (   1) MLPS -15.25 deficit  11.15 prct   0.00 CutScore -17.35;  Ed  0, 0 matches the original group, cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00          CUGU*ACUAGG (   1) MLPS -15.99 deficit  11.89 prct   0.00 CutScore -25.21;  Ed  0, 0 matches the original group, cWW-cWH-cWW

Model IL_82444.1 was the best-scoring model for   29 sequences (100.0%) cWW-cWH-cWW <-- correct model

Group 111 is from IL_40892.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_40892.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWS-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AUGAAGC*GGGU (   1) MLPS  -6.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWS-L-L-cWW
Better:   0 Equal:   0 Score 1.00         GUGAAGA*UUGC (   1) MLPS  -7.65 deficit   0.85 prct   0.00 CutScore  94.67;  Ed  0, 0 matches the original group, cWW-cWS-L-L-cWW

Model IL_40892.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWS-L-L-cWW <-- correct model

Group 258 is from IL_94430.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94430.5
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               GAG*CC (   1) MLPS  -4.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   1 Score 0.50              CCAG*CG (   1) MLPS  -4.60 deficit   0.41 prct   0.00 CutScore  95.70;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   1 Score 0.50              CCAG*CG (   1) MLPS  -4.60 deficit   0.41 prct   0.00 CutScore  95.70;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   1 Score 0.50              GAAU*AC (   1) MLPS  -4.83 deficit   0.64 prct   0.00 CutScore  93.31;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   2 Score 0.33               UAG*CA (   1) MLPS  -4.83 deficit   0.64 prct   0.00 CutScore  93.21;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -5.02 deficit   0.83 prct   0.00 CutScore  91.25;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -5.02 deficit   0.83 prct   0.00 CutScore  91.25;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -5.02 deficit   0.83 prct   0.00 CutScore  91.25;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00              GUAG*CC (   1) MLPS  -5.30 deficit   1.11 prct   0.00 CutScore  88.31;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00              UAAC*GA (   1) MLPS  -5.48 deficit   1.29 prct   0.00 CutScore  86.46;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   1 Score 0.50               GAU*GC (   1) MLPS  -5.87 deficit   1.68 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00             GACAG*CC (   1) MLPS  -6.30 deficit   2.11 prct   0.00 CutScore  77.82;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00               AGC*GU (   1) MLPS  -6.31 deficit   2.12 prct   0.00 CutScore  77.67;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00             GACAU*AC (   1) MLPS  -6.61 deficit   2.42 prct   0.00 CutScore  74.52;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   0 Score 1.00             GACAU*AC (   1) MLPS  -6.61 deficit   2.42 prct   0.00 CutScore  74.52;  Ed  0, 0 matches the original group, cWW-cWS-cWW
Better:   0 Equal:   1 Score 0.50              GUCG*CC (   1) MLPS  -7.33 deficit   3.14 prct   0.00 CutScore  66.94;  Ed  0, 0 matches the original group, cWW-cWS-cWW

Model IL_94430.5 was the best-scoring model for   16 sequences (100.0%) cWW-cWS-cWW <-- correct model

Group 220 is from IL_82650.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82650.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cWS-tSH-tHS-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GGAACAC*GCAAUC (   1) MLPS  -8.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWS-tSH-tHS-L-R-L-cWW

Model IL_82650.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWS-tSH-tHS-L-R-L-cWW <-- correct model

Group  35 is from IL_13069.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13069.3
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGG*CAAUC (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGG*UAAUC (   1) MLPS  -6.09 deficit   0.11 prct   0.00 CutScore  98.94;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGG*UAAUC (   1) MLPS  -6.09 deficit   0.11 prct   0.00 CutScore  98.94;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGA*UAACC (   1) MLPS  -6.23 deficit   0.25 prct   0.00 CutScore  97.51;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGA*UAACC (   1) MLPS  -6.23 deficit   0.25 prct   0.00 CutScore  97.51;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGG*CCAUC (   1) MLPS  -7.17 deficit   1.19 prct   0.00 CutScore  88.18;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_13069.3 was the best-scoring model for    6 sequences (100.0%) cWW-cWW <-- correct model

Group  68 is from IL_25300.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25300.3
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20               UAG*CG (   1) MLPS  -4.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GCG*CC (   1) MLPS  -4.99 deficit   0.23 prct   0.00 CutScore  97.57;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CAG*CG (   1) MLPS  -5.05 deficit   0.28 prct   0.00 CutScore  97.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GUU*AC (   1) MLPS  -5.49 deficit   0.72 prct   0.00 CutScore  92.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GA (   1) MLPS  -5.98 deficit   1.22 prct   0.00 CutScore  87.20;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UAUC*GG (   1) MLPS  -7.20 deficit   2.44 prct   0.00 CutScore  74.34;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UCCG*UG (   1) MLPS  -7.78 deficit   3.02 prct   0.00 CutScore  68.20;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_25300.3 was the best-scoring model for    7 sequences (100.0%) cWW-cWW <-- correct model

Group  79 is from IL_28947.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28947.2
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   4 Score 0.20               CAG*CG (   1) MLPS  -4.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CAG*CG (   1) MLPS  -4.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CAG*CG (   1) MLPS  -4.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CAG*CG (   1) MLPS  -4.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               UAG*CG (   1) MLPS  -4.74 deficit   0.41 prct   0.00 CutScore  95.68;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CAG*UG (   1) MLPS  -5.00 deficit   0.67 prct   0.00 CutScore  92.98;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               UGG*CG (   1) MLPS  -5.47 deficit   1.14 prct   0.00 CutScore  88.04;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CG (   1) MLPS  -5.47 deficit   1.14 prct   0.00 CutScore  88.04;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CCG*CG (   1) MLPS  -5.82 deficit   1.49 prct   0.00 CutScore  84.34;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GGC*GC (   1) MLPS  -5.87 deficit   1.54 prct   0.00 CutScore  83.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAUG*CG (   1) MLPS  -6.02 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UUG*UA (   1) MLPS  -6.13 deficit   1.80 prct   0.00 CutScore  81.07;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UUG*UG (   1) MLPS  -6.13 deficit   1.80 prct   0.00 CutScore  81.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAUG*CC (   1) MLPS  -6.35 deficit   2.02 prct   0.00 CutScore  78.78;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              CGAA*UG (   1) MLPS  -6.38 deficit   2.05 prct   0.00 CutScore  78.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAUG*CU (   1) MLPS  -6.50 deficit   2.17 prct   0.00 CutScore  77.14;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              GGAA*UC (   1) MLPS  -6.70 deficit   2.37 prct   0.00 CutScore  75.03;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGUG*CG (   1) MLPS  -6.75 deficit   2.42 prct   0.00 CutScore  74.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UGAA*UG (   1) MLPS  -6.79 deficit   2.46 prct   0.00 CutScore  74.11;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UGAA*UG (   1) MLPS  -6.79 deficit   2.46 prct   0.00 CutScore  74.11;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CACG*UG (   1) MLPS  -7.45 deficit   3.12 prct   0.00 CutScore  67.14;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UACG*UA (   1) MLPS  -7.86 deficit   3.53 prct   0.00 CutScore  62.87;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_28947.2 was the best-scoring model for   22 sequences (100.0%) cWW-cWW <-- correct model

Group 138 is from IL_47875.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47875.1
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33               UUG*UA (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00           CGUAAAG*CG (   1) MLPS  -8.71 deficit   2.74 prct   0.00 CutScore  71.13;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00           CGUAAAG*CG (   1) MLPS  -8.71 deficit   2.74 prct   0.00 CutScore  71.13;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_47875.1 was the best-scoring model for    3 sequences (100.0%) cWW-cWW <-- correct model

Group 227 is from IL_86059.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86059.1
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             AAG*CUAU (   1) MLPS  -5.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_86059.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW <-- correct model

Group 252 is from IL_92109.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92109.3
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -4.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -5.06 deficit   0.35 prct   0.00 CutScore  96.30;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -5.06 deficit   0.35 prct   0.00 CutScore  96.30;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GC*GCC (   1) MLPS  -5.17 deficit   0.46 prct   0.00 CutScore  95.13;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -5.28 deficit   0.57 prct   0.00 CutScore  93.99;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AACG (   1) MLPS  -6.22 deficit   1.51 prct   0.00 CutScore  84.08;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AACG (   1) MLPS  -6.22 deficit   1.51 prct   0.00 CutScore  84.08;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CG*CACG (   1) MLPS  -6.24 deficit   1.53 prct   0.00 CutScore  83.85;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CG*CACG (   1) MLPS  -6.24 deficit   1.53 prct   0.00 CutScore  83.85;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CA*UACG (   1) MLPS  -6.32 deficit   1.62 prct   0.00 CutScore  82.99;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              CC*GUCG (   1) MLPS  -6.34 deficit   1.63 prct   0.00 CutScore  82.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GU*GGC (   1) MLPS  -8.46 deficit   3.75 prct   0.00 CutScore  60.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             CU*ACAUG (   1) MLPS  -9.24 deficit   4.53 prct   0.00 CutScore  52.29;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00           UC*GUUAAAA (   1) MLPS -10.26 deficit   5.55 prct   0.00 CutScore  41.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00           UC*GUUAAAA (   1) MLPS -10.26 deficit   5.55 prct   0.00 CutScore  41.59;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_92109.3 was the best-scoring model for   15 sequences (100.0%) cWW-cWW <-- correct model

Group 267 is from IL_97217.11 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97217.11
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CC*GAG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GUG (   1) MLPS  -3.31 deficit   0.15 prct   0.00 CutScore  98.42;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.34 deficit   0.19 prct   0.00 CutScore  98.05;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -3.49 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UC*GAA (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UC*GAA (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UC*GAA (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UC*GAA (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UC*GAA (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AC*GAU (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AC*GAU (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AC*GAU (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AC*GAU (   1) MLPS  -3.82 deficit   0.66 prct   0.00 CutScore  93.02;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               AC*GUU (   1) MLPS  -3.97 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -4.07 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CG*CUG (   1) MLPS  -4.22 deficit   1.07 prct   0.00 CutScore  88.77;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CC*GCG (   1) MLPS  -4.25 deficit   1.09 prct   0.00 CutScore  88.53;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -4.26 deficit   1.10 prct   0.00 CutScore  88.41;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -4.26 deficit   1.10 prct   0.00 CutScore  88.41;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -4.26 deficit   1.10 prct   0.00 CutScore  88.41;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -4.26 deficit   1.10 prct   0.00 CutScore  88.41;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -4.26 deficit   1.10 prct   0.00 CutScore  88.41;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CU*AAG (   1) MLPS  -4.29 deficit   1.13 prct   0.00 CutScore  88.10;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CU*AAG (   1) MLPS  -4.29 deficit   1.13 prct   0.00 CutScore  88.10;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               CU*AAG (   1) MLPS  -4.29 deficit   1.13 prct   0.00 CutScore  88.10;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*CUC (   1) MLPS  -4.41 deficit   1.25 prct   0.00 CutScore  86.82;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*CUC (   1) MLPS  -4.41 deficit   1.25 prct   0.00 CutScore  86.82;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GC*GCC (   1) MLPS  -4.43 deficit   1.28 prct   0.00 CutScore  86.57;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GC*GCC (   1) MLPS  -4.43 deficit   1.28 prct   0.00 CutScore  86.57;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CA*UUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CA*UUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CU*AUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CU*AUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CU*AUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               CU*AUG (   1) MLPS  -4.44 deficit   1.28 prct   0.00 CutScore  86.52;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.47 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GA*UUC (   1) MLPS  -4.62 deficit   1.47 prct   0.00 CutScore  84.56;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GU*AUC (   1) MLPS  -4.62 deficit   1.47 prct   0.00 CutScore  84.56;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GU*AUC (   1) MLPS  -4.62 deficit   1.47 prct   0.00 CutScore  84.56;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   4 Score 0.20               CG*UAG (   1) MLPS  -4.62 deficit   1.47 prct   0.00 CutScore  84.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33               UG*CAA (   1) MLPS  -4.73 deficit   1.58 prct   0.00 CutScore  83.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AG*CAU (   1) MLPS  -4.73 deficit   1.58 prct   0.00 CutScore  83.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AG*CAU (   1) MLPS  -4.73 deficit   1.58 prct   0.00 CutScore  83.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AG*CAU (   1) MLPS  -4.73 deficit   1.58 prct   0.00 CutScore  83.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               AG*CAU (   1) MLPS  -4.73 deficit   1.58 prct   0.00 CutScore  83.38;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -4.81 deficit   1.65 prct   0.00 CutScore  82.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -4.81 deficit   1.65 prct   0.00 CutScore  82.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -4.81 deficit   1.65 prct   0.00 CutScore  82.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AG*CUU (   1) MLPS  -4.88 deficit   1.73 prct   0.00 CutScore  81.79;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AC*GCU (   1) MLPS  -4.91 deficit   1.75 prct   0.00 CutScore  81.55;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AC*GCU (   1) MLPS  -4.91 deficit   1.75 prct   0.00 CutScore  81.55;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AC*GCU (   1) MLPS  -4.91 deficit   1.75 prct   0.00 CutScore  81.55;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AC*GCU (   1) MLPS  -4.91 deficit   1.75 prct   0.00 CutScore  81.55;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UAA (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UAA (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UAA (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AAU (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AAU (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AAU (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AAU (   1) MLPS  -4.95 deficit   1.79 prct   0.00 CutScore  81.12;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UUC (   1) MLPS  -4.96 deficit   1.80 prct   0.00 CutScore  81.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UUC (   1) MLPS  -4.96 deficit   1.80 prct   0.00 CutScore  81.00;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GGA (   1) MLPS  -5.05 deficit   1.89 prct   0.00 CutScore  80.09;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UA*UUA (   1) MLPS  -5.10 deficit   1.94 prct   0.00 CutScore  79.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*AUA (   1) MLPS  -5.10 deficit   1.94 prct   0.00 CutScore  79.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AUU (   1) MLPS  -5.10 deficit   1.94 prct   0.00 CutScore  79.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AUU (   1) MLPS  -5.10 deficit   1.94 prct   0.00 CutScore  79.54;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GUG (   1) MLPS  -5.19 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GUG (   1) MLPS  -5.19 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GUG (   1) MLPS  -5.19 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GUG (   1) MLPS  -5.19 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GUG (   1) MLPS  -5.19 deficit   2.03 prct   0.00 CutScore  78.59;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*CCC (   1) MLPS  -5.35 deficit   2.19 prct   0.00 CutScore  76.93;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GC*GAU (   1) MLPS  -5.37 deficit   2.22 prct   0.00 CutScore  76.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GC*GAU (   1) MLPS  -5.37 deficit   2.22 prct   0.00 CutScore  76.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CA*UCG (   1) MLPS  -5.38 deficit   2.22 prct   0.00 CutScore  76.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CA*UCG (   1) MLPS  -5.38 deficit   2.22 prct   0.00 CutScore  76.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CA*UCG (   1) MLPS  -5.38 deficit   2.22 prct   0.00 CutScore  76.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CA*UCG (   1) MLPS  -5.38 deficit   2.22 prct   0.00 CutScore  76.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               CU*GAG (   1) MLPS  -5.38 deficit   2.22 prct   0.00 CutScore  76.62;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*CGC (   1) MLPS  -5.49 deficit   2.33 prct   0.00 CutScore  75.47;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*CGC (   1) MLPS  -5.49 deficit   2.33 prct   0.00 CutScore  75.47;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GU*GAC (   1) MLPS  -5.56 deficit   2.41 prct   0.00 CutScore  74.67;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GU*GAC (   1) MLPS  -5.56 deficit   2.41 prct   0.00 CutScore  74.67;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UG*CCA (   1) MLPS  -5.82 deficit   2.67 prct   0.00 CutScore  71.91;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UG*CCA (   1) MLPS  -5.82 deficit   2.67 prct   0.00 CutScore  71.91;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -5.85 deficit   2.70 prct   0.00 CutScore  71.60;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GG*UCC (   1) MLPS  -5.90 deficit   2.74 prct   0.00 CutScore  71.11;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UCA (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UCA (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GG*UGC (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GG*UGC (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GG*UGC (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GG*UGC (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GG*UGC (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.65;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*GAU (   1) MLPS  -6.04 deficit   2.88 prct   0.00 CutScore  69.64;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   3 Score 0.25              CC*GAAG (   1) MLPS  -6.07 deficit   2.92 prct   0.00 CutScore  69.28;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GCG (   1) MLPS  -6.13 deficit   2.97 prct   0.00 CutScore  68.70;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UC*GCG (   1) MLPS  -6.13 deficit   2.97 prct   0.00 CutScore  68.70;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UGA (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.19;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UA*UGA (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.19;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AA*UGU (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AA*UGU (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AGU (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AGU (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               AU*AGU (   1) MLPS  -6.18 deficit   3.02 prct   0.00 CutScore  68.18;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*AUG (   1) MLPS  -6.32 deficit   3.16 prct   0.00 CutScore  66.69;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CC*GUUG (   1) MLPS  -6.37 deficit   3.22 prct   0.00 CutScore  66.11;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GU*AAU (   1) MLPS  -6.50 deficit   3.35 prct   0.00 CutScore  64.75;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UG*UGA (   1) MLPS  -6.52 deficit   3.36 prct   0.00 CutScore  64.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               UG*UGA (   1) MLPS  -6.52 deficit   3.36 prct   0.00 CutScore  64.63;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GC*GGU (   1) MLPS  -6.60 deficit   3.45 prct   0.00 CutScore  63.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               GC*GGU (   1) MLPS  -6.60 deficit   3.45 prct   0.00 CutScore  63.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50               GU*GGC (   1) MLPS  -6.79 deficit   3.64 prct   0.00 CutScore  61.74;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              GG*CAAC (   1) MLPS  -7.18 deficit   4.02 prct   0.00 CutScore  57.69;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGA (   1) MLPS  -7.27 deficit   4.11 prct   0.00 CutScore  56.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGA (   1) MLPS  -7.27 deficit   4.11 prct   0.00 CutScore  56.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGA (   1) MLPS  -7.27 deficit   4.11 prct   0.00 CutScore  56.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGA (   1) MLPS  -7.27 deficit   4.11 prct   0.00 CutScore  56.71;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAC (   1) MLPS  -7.35 deficit   4.19 prct   0.00 CutScore  55.85;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAC (   1) MLPS  -7.35 deficit   4.19 prct   0.00 CutScore  55.85;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAC (   1) MLPS  -7.35 deficit   4.19 prct   0.00 CutScore  55.85;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCUC (   1) MLPS  -7.50 deficit   4.34 prct   0.00 CutScore  54.27;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AUUG (   1) MLPS  -7.51 deficit   4.35 prct   0.00 CutScore  54.21;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GA*UUAC (   1) MLPS  -7.54 deficit   4.38 prct   0.00 CutScore  53.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GU*AAUC (   1) MLPS  -7.54 deficit   4.38 prct   0.00 CutScore  53.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*CAAA (   1) MLPS  -7.65 deficit   4.50 prct   0.00 CutScore  52.66;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GG*UUUC (   1) MLPS  -8.03 deficit   4.87 prct   0.00 CutScore  48.70;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GG*UUUC (   1) MLPS  -8.03 deficit   4.87 prct   0.00 CutScore  48.70;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              UG*UAAA (   1) MLPS  -8.21 deficit   5.05 prct   0.00 CutScore  46.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              UG*UAAA (   1) MLPS  -8.21 deficit   5.05 prct   0.00 CutScore  46.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              UG*UAAA (   1) MLPS  -8.21 deficit   5.05 prct   0.00 CutScore  46.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   1 Score 0.50              UG*UAAA (   1) MLPS  -8.21 deficit   5.05 prct   0.00 CutScore  46.84;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AAGG (   1) MLPS  -8.43 deficit   5.28 prct   0.00 CutScore  44.44;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGG (   1) MLPS  -8.49 deficit   5.33 prct   0.00 CutScore  43.86;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00               UU*GGG (   1) MLPS  -8.49 deficit   5.33 prct   0.00 CutScore  43.86;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GG*UGAC (   1) MLPS  -8.96 deficit   5.80 prct   0.00 CutScore  38.93;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GG*UAGC (   1) MLPS  -8.96 deficit   5.80 prct   0.00 CutScore  38.93;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GG*UAGC (   1) MLPS  -8.96 deficit   5.80 prct   0.00 CutScore  38.93;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UU*AAUG (   1) MLPS  -9.24 deficit   6.08 prct   0.00 CutScore  35.97;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*UCAA (   1) MLPS  -9.30 deficit   6.14 prct   0.00 CutScore  35.37;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAU (   1) MLPS  -9.38 deficit   6.23 prct   0.00 CutScore  34.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAU (   1) MLPS  -9.38 deficit   6.23 prct   0.00 CutScore  34.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              GC*GCAU (   1) MLPS  -9.38 deficit   6.23 prct   0.00 CutScore  34.46;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   2 Score 0.33              AG*UAGU (   1) MLPS  -9.43 deficit   6.28 prct   0.00 CutScore  33.90;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              AA*UCGU (   1) MLPS -10.19 deficit   7.03 prct   0.00 CutScore  25.99;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UU*ACUG (   1) MLPS -10.33 deficit   7.17 prct   0.00 CutScore  24.49;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             CC*GUUCG (   1) MLPS -10.64 deficit   7.49 prct   0.00 CutScore  21.17;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             CC*GUUCG (   1) MLPS -10.64 deficit   7.49 prct   0.00 CutScore  21.17;  Ed  0, 0 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             CU*AUCUG (   1) MLPS -11.77 deficit   8.62 prct   0.00 CutScore   9.27;  Ed  0, 0 matches the original group, cWW-cWW

Model IL_97217.11 was the best-scoring model for  248 sequences (100.0%) cWW-cWW <-- correct model

Group 146 is from IL_52509.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52509.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-L-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUGAAG*CGUG (   1) MLPS  -6.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-L-tHS-cWW

Model IL_52509.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-L-L-tHS-cWW <-- correct model

Group 245 is from IL_90735.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90735.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-cWW-L-R-R-R-R-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAAAAAAUU*AUAUUAGC (   1) MLPS  -9.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-R-R-L-L-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00   GAAAAAAUU*ACAUUAGC (   1) MLPS  -9.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-R-R-L-L-L-L-L-cWW

Model IL_90735.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-L-R-R-R-R-L-L-L-L-L-cWW <-- correct model

Group  74 is from IL_27640.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_27640.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cWW-L-R-R-R-R-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GAGUAG*UGCAUCCGC (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-R-R-R-L-tHS-cWW

Model IL_27640.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-L-R-R-R-R-R-L-tHS-cWW <-- correct model

Group  41 is from IL_16330.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16330.1
This group is considered to be structured ***************************
Number of NTs: 25  Signature: cWW-cWW-L-R-R-R-R-R-R-R-R-R-L-L-L-L-L-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GACACCACAAAA*UGAAAAUGGAUGGCGC (   1) MLPS -14.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-R-R-R-R-R-R-R-L-L-L-L-L-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00 GAUACCACAAAA*UGAAAAUGGAUGGCGC (   1) MLPS -14.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-R-R-R-R-R-R-R-L-L-L-L-L-tHH-tHS-cWW

Model IL_16330.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-L-R-R-R-R-R-R-R-R-R-L-L-L-L-L-tHH-tHS-cWW <-- correct model

Group  65 is from IL_25181.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25181.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cWW-L-R-R-tHW-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UUAUCA*UCUUAUG (   1) MLPS  -6.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-R-tHW-bif-cWW

Model IL_25181.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-L-R-R-tHW-bif-cWW <-- correct model

Group 259 is from IL_94744.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94744.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-cWW-L-R-tSH-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAUGAGUAG*UGAAAGGC (   1) MLPS  -8.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00   GAUGAGUAG*UGAAAGGC (   1) MLPS  -8.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-R-tSH-tHH-cSH-tWH-tHS-cWW

Model IL_94744.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-L-R-tSH-tHH-cSH-tWH-tHS-cWW <-- correct model

Group  38 is from IL_15205.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15205.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWW-L-cSW-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GCAUAAG*UGCUAC (   1) MLPS  -8.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-cSW-L-tHS-cWW

Model IL_15205.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-L-cSW-L-tHS-cWW <-- correct model

Group 223 is from IL_83920.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83920.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAAA*UGC (   1) MLPS  -4.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-cWW

Model IL_83920.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-L-cWW <-- correct model

Group  82 is from IL_30840.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_30840.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-L-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UUAUUU*AUCUA (   1) MLPS  -8.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-L-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00         UUAUUU*AUUCA (   1) MLPS  -9.02 deficit   0.85 prct   0.00 CutScore  95.13;  Ed  0, 0 matches the original group, cWW-cWW-L-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GAGCAAU*AUGGC (   1) MLPS -12.59 deficit   4.42 prct   0.00 CutScore  74.66;  Ed  0, 0 matches the original group, cWW-cWW-L-cWW-cWW-cWW

Model IL_30840.2 was the best-scoring model for    3 sequences (100.0%) cWW-cWW-L-cWW-cWW-cWW <-- correct model

Group  84 is from IL_31039.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31039.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGU*AUAC (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-R-cWW
Better:   0 Equal:   0 Score 1.00             GGU*AUAC (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-R-cWW

Model IL_31039.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-R-cWW <-- correct model

Group 190 is from IL_71685.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_71685.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-bif-R-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GAGGUAA*UAAAUAU (   1) MLPS  -6.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-bif-R-cSH-tWH-tHS-cWW

Model IL_71685.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-bif-R-cSH-tWH-tHS-cWW <-- correct model

Group   9 is from IL_05221.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05221.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cWW-bif-tHW-cWH-tSW-cSH-cWH-cSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAAUGUAG*UAUUAUAGC (   1) MLPS  -6.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-bif-tHW-cWH-tSW-cSH-cWH-cSH-tHS-cWW

Model IL_05221.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-bif-tHW-cWH-tSW-cSH-cWH-cSH-tHS-cWW <-- correct model

Group  70 is from IL_25380.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25380.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cSH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50            AUC*GGUUU (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            GUG*CCUUC (   1) MLPS  -5.50 deficit   0.02 prct   0.00 CutScore  99.77;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            AUA*UGUUU (   1) MLPS  -5.62 deficit   0.14 prct   0.00 CutScore  98.65;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            CAC*GGAAG (   1) MLPS  -8.14 deficit   2.66 prct   0.00 CutScore  75.10;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00            CAC*GGAAG (   1) MLPS  -8.14 deficit   2.66 prct   0.00 CutScore  75.10;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00          ACUAG*CUUCU (   1) MLPS -10.12 deficit   4.64 prct   0.00 CutScore  56.55;  Ed  0, 0 matches the original group, cWW-cWW-cSH-R-cWW

Model IL_25380.1 was the best-scoring model for    6 sequences (100.0%) cWW-cWW-cSH-R-cWW <-- correct model

Group  88 is from IL_31663.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31663.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGGG*UAC (   1) MLPS  -4.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSH-cWW
Better:   0 Equal:   1 Score 0.50             GCGG*UAC (   1) MLPS  -5.86 deficit   0.89 prct   0.00 CutScore  90.62;  Ed  0, 0 matches the original group, cWW-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GAAUG*CGC (   1) MLPS  -6.51 deficit   1.54 prct   0.00 CutScore  83.76;  Ed  0, 0 matches the original group, cWW-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GGUCA*UAC (   1) MLPS  -7.59 deficit   2.62 prct   0.00 CutScore  72.39;  Ed  0, 0 matches the original group, cWW-cWW-cSH-cWW

Model IL_31663.1 was the best-scoring model for    4 sequences (100.0%) cWW-cWW-cSH-cWW <-- correct model

Group 156 is from IL_54966.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54966.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cWW-cSW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           GCCC*GUAAC (   1) MLPS  -5.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50           GCCC*GUAAC (   1) MLPS  -5.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50           GCCC*GUAAC (   1) MLPS  -5.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSW-cSH-cWW
Better:   0 Equal:   1 Score 0.50           GCCC*GUAAC (   1) MLPS  -5.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cSW-cSH-cWW

Model IL_54966.1 was the best-scoring model for    4 sequences (100.0%) cWW-cWW-cSW-cSH-cWW <-- correct model

Group  43 is from IL_17066.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17066.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW

Model IL_17066.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-cWW <-- correct model

Group 133 is from IL_47174.11 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47174.11
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CUG*CUG (   1) MLPS  -3.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              GUC*GUC (   1) MLPS  -3.70 deficit   0.31 prct   0.00 CutScore  96.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUC*GUG (   1) MLPS  -3.74 deficit   0.36 prct   0.00 CutScore  96.23;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.76 deficit   0.38 prct   0.00 CutScore  96.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.76 deficit   0.38 prct   0.00 CutScore  96.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -4.12 deficit   0.73 prct   0.00 CutScore  92.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUU*AUC (   1) MLPS  -4.30 deficit   0.92 prct   0.00 CutScore  90.33;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUU*AUC (   1) MLPS  -4.30 deficit   0.92 prct   0.00 CutScore  90.33;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUU*AUC (   1) MLPS  -4.30 deficit   0.92 prct   0.00 CutScore  90.33;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUU*AUC (   1) MLPS  -4.30 deficit   0.92 prct   0.00 CutScore  90.33;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUU*AUG (   1) MLPS  -4.35 deficit   0.96 prct   0.00 CutScore  89.87;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUU*AUG (   1) MLPS  -4.35 deficit   0.96 prct   0.00 CutScore  89.87;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUU*AUG (   1) MLPS  -4.35 deficit   0.96 prct   0.00 CutScore  89.87;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -4.61 deficit   1.23 prct   0.00 CutScore  87.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -4.61 deficit   1.23 prct   0.00 CutScore  87.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -4.61 deficit   1.23 prct   0.00 CutScore  87.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*AUU (   1) MLPS  -4.72 deficit   1.34 prct   0.00 CutScore  85.92;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CAG (   1) MLPS  -4.86 deficit   1.48 prct   0.00 CutScore  84.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GAC (   1) MLPS  -4.97 deficit   1.59 prct   0.00 CutScore  83.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GAC (   1) MLPS  -4.97 deficit   1.59 prct   0.00 CutScore  83.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GAC (   1) MLPS  -4.97 deficit   1.59 prct   0.00 CutScore  83.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GAC (   1) MLPS  -4.97 deficit   1.59 prct   0.00 CutScore  83.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CCC (   1) MLPS  -4.99 deficit   1.60 prct   0.00 CutScore  83.14;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -5.03 deficit   1.64 prct   0.00 CutScore  82.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -5.10 deficit   1.72 prct   0.00 CutScore  81.95;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -5.10 deficit   1.72 prct   0.00 CutScore  81.95;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -5.10 deficit   1.72 prct   0.00 CutScore  81.95;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -5.10 deficit   1.72 prct   0.00 CutScore  81.95;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUU (   1) MLPS  -5.10 deficit   1.72 prct   0.00 CutScore  81.88;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CAU (   1) MLPS  -5.24 deficit   1.85 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CAU (   1) MLPS  -5.24 deficit   1.85 prct   0.00 CutScore  80.51;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAG*CGG (   1) MLPS  -5.26 deficit   1.87 prct   0.00 CutScore  80.29;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GCC (   1) MLPS  -5.34 deficit   1.96 prct   0.00 CutScore  79.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GCC (   1) MLPS  -5.34 deficit   1.96 prct   0.00 CutScore  79.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CAG*CAG (   1) MLPS  -5.36 deficit   1.98 prct   0.00 CutScore  79.18;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CAG*CAG (   1) MLPS  -5.36 deficit   1.98 prct   0.00 CutScore  79.18;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CAG*CAG (   1) MLPS  -5.36 deficit   1.98 prct   0.00 CutScore  79.18;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AGC*GAU (   1) MLPS  -5.39 deficit   2.01 prct   0.00 CutScore  78.87;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GCG (   1) MLPS  -5.40 deficit   2.02 prct   0.00 CutScore  78.76;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              AUG*CCU (   1) MLPS  -5.40 deficit   2.02 prct   0.00 CutScore  78.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              AUG*CCU (   1) MLPS  -5.40 deficit   2.02 prct   0.00 CutScore  78.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              AUG*CCU (   1) MLPS  -5.40 deficit   2.02 prct   0.00 CutScore  78.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUU (   1) MLPS  -5.46 deficit   2.08 prct   0.00 CutScore  78.11;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUU*AUA (   1) MLPS  -5.47 deficit   2.08 prct   0.00 CutScore  78.08;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUU*AUA (   1) MLPS  -5.47 deficit   2.08 prct   0.00 CutScore  78.08;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUU*AUA (   1) MLPS  -5.47 deficit   2.08 prct   0.00 CutScore  78.08;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUU*AUA (   1) MLPS  -5.47 deficit   2.08 prct   0.00 CutScore  78.08;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*UUU (   1) MLPS  -5.47 deficit   2.09 prct   0.00 CutScore  77.99;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*UUU (   1) MLPS  -5.47 deficit   2.09 prct   0.00 CutScore  77.99;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACC*GAU (   1) MLPS  -5.59 deficit   2.21 prct   0.00 CutScore  76.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACC*GAU (   1) MLPS  -5.59 deficit   2.21 prct   0.00 CutScore  76.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GCU (   1) MLPS  -5.78 deficit   2.39 prct   0.00 CutScore  74.81;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GCU (   1) MLPS  -5.78 deficit   2.39 prct   0.00 CutScore  74.81;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GCU (   1) MLPS  -5.78 deficit   2.39 prct   0.00 CutScore  74.81;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*AAC (   1) MLPS  -5.78 deficit   2.40 prct   0.00 CutScore  74.79;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*AAC (   1) MLPS  -5.78 deficit   2.40 prct   0.00 CutScore  74.79;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              UUA*UUA (   1) MLPS  -5.78 deficit   2.40 prct   0.00 CutScore  74.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              UUA*UUA (   1) MLPS  -5.78 deficit   2.40 prct   0.00 CutScore  74.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -5.79 deficit   2.41 prct   0.00 CutScore  74.68;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -5.79 deficit   2.41 prct   0.00 CutScore  74.68;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CCU*AAG (   1) MLPS  -5.82 deficit   2.44 prct   0.00 CutScore  74.33;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGA*UAG (   1) MLPS  -5.93 deficit   2.55 prct   0.00 CutScore  73.17;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGA*UAG (   1) MLPS  -5.93 deficit   2.55 prct   0.00 CutScore  73.17;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGA*UAG (   1) MLPS  -5.93 deficit   2.55 prct   0.00 CutScore  73.17;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGA*UAG (   1) MLPS  -5.93 deficit   2.55 prct   0.00 CutScore  73.17;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              UCG*CAA (   1) MLPS  -5.98 deficit   2.60 prct   0.00 CutScore  72.66;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GGU (   1) MLPS  -5.99 deficit   2.61 prct   0.00 CutScore  72.57;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GGU (   1) MLPS  -5.99 deficit   2.61 prct   0.00 CutScore  72.57;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GAU (   1) MLPS  -6.10 deficit   2.71 prct   0.00 CutScore  71.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   2 Score 0.33              GCC*GCC (   1) MLPS  -6.10 deficit   2.72 prct   0.00 CutScore  71.36;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUA*UCG (   1) MLPS  -6.30 deficit   2.92 prct   0.00 CutScore  69.26;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AGA*UAU (   1) MLPS  -6.31 deficit   2.92 prct   0.00 CutScore  69.22;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AGA*UAU (   1) MLPS  -6.31 deficit   2.92 prct   0.00 CutScore  69.22;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*UAC (   1) MLPS  -6.33 deficit   2.95 prct   0.00 CutScore  68.99;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*ACU (   1) MLPS  -6.37 deficit   2.98 prct   0.00 CutScore  68.61;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*ACU (   1) MLPS  -6.37 deficit   2.98 prct   0.00 CutScore  68.61;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*ACU (   1) MLPS  -6.37 deficit   2.98 prct   0.00 CutScore  68.61;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAU (   1) MLPS  -6.38 deficit   2.99 prct   0.00 CutScore  68.48;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAU (   1) MLPS  -6.38 deficit   2.99 prct   0.00 CutScore  68.48;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAU*ACU (   1) MLPS  -6.38 deficit   3.00 prct   0.00 CutScore  68.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAU*ACU (   1) MLPS  -6.38 deficit   3.00 prct   0.00 CutScore  68.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAU*ACU (   1) MLPS  -6.38 deficit   3.00 prct   0.00 CutScore  68.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAU*ACU (   1) MLPS  -6.38 deficit   3.00 prct   0.00 CutScore  68.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              ACA*UAU (   1) MLPS  -6.51 deficit   3.13 prct   0.00 CutScore  67.09;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCG*CAU (   1) MLPS  -6.58 deficit   3.20 prct   0.00 CutScore  66.35;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*UCC (   1) MLPS  -6.72 deficit   3.33 prct   0.00 CutScore  64.93;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*UCC (   1) MLPS  -6.72 deficit   3.33 prct   0.00 CutScore  64.93;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AGG*UAU (   1) MLPS  -6.75 deficit   3.36 prct   0.00 CutScore  64.59;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCU (   1) MLPS  -6.76 deficit   3.38 prct   0.00 CutScore  64.42;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCU (   1) MLPS  -6.76 deficit   3.38 prct   0.00 CutScore  64.42;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UAC*GAA (   1) MLPS  -6.84 deficit   3.46 prct   0.00 CutScore  63.61;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              CGG*CGG (   1) MLPS  -6.91 deficit   3.52 prct   0.00 CutScore  62.90;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*AUU (   1) MLPS  -6.96 deficit   3.57 prct   0.00 CutScore  62.41;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CGU (   1) MLPS  -6.98 deficit   3.59 prct   0.00 CutScore  62.17;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*ACU (   1) MLPS  -7.13 deficit   3.74 prct   0.00 CutScore  60.60;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*ACU (   1) MLPS  -7.13 deficit   3.74 prct   0.00 CutScore  60.60;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*CAG (   1) MLPS  -7.21 deficit   3.83 prct   0.00 CutScore  59.70;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUA*UUG (   1) MLPS  -7.21 deficit   3.83 prct   0.00 CutScore  59.68;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUA*UUG (   1) MLPS  -7.21 deficit   3.83 prct   0.00 CutScore  59.68;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              ACA*UUU (   1) MLPS  -7.27 deficit   3.88 prct   0.00 CutScore  59.11;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GGU (   1) MLPS  -7.34 deficit   3.95 prct   0.00 CutScore  58.40;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCG*CCU (   1) MLPS  -7.51 deficit   4.13 prct   0.00 CutScore  56.56;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UCU*AUA (   1) MLPS  -7.70 deficit   4.32 prct   0.00 CutScore  54.56;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGAG*CAC (   1) MLPS  -7.72 deficit   4.33 prct   0.00 CutScore  54.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GCAG*CAC (   1) MLPS  -7.92 deficit   4.54 prct   0.00 CutScore  52.24;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50              UGG*CGA (   1) MLPS  -8.03 deficit   4.65 prct   0.00 CutScore  51.10;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UCA*UCA (   1) MLPS  -8.19 deficit   4.80 prct   0.00 CutScore  49.46;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GCAC*GAC (   1) MLPS  -8.28 deficit   4.90 prct   0.00 CutScore  48.47;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50             GAAG*CGC (   1) MLPS  -8.32 deficit   4.93 prct   0.00 CutScore  48.07;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50             GAAG*CGC (   1) MLPS  -8.32 deficit   4.93 prct   0.00 CutScore  48.07;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50             GAAG*CGC (   1) MLPS  -8.32 deficit   4.93 prct   0.00 CutScore  48.07;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UCG*CCG (   1) MLPS  -8.34 deficit   4.96 prct   0.00 CutScore  47.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*GUC (   1) MLPS  -8.37 deficit   4.99 prct   0.00 CutScore  47.52;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -8.42 deficit   5.04 prct   0.00 CutScore  46.96;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -8.42 deficit   5.04 prct   0.00 CutScore  46.96;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -8.42 deficit   5.04 prct   0.00 CutScore  46.96;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   5 Score 0.17             GAAG*CAC (   1) MLPS  -8.42 deficit   5.04 prct   0.00 CutScore  46.96;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAGG*CAC (   1) MLPS  -8.48 deficit   5.09 prct   0.00 CutScore  46.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAGG*CAC (   1) MLPS  -8.48 deficit   5.09 prct   0.00 CutScore  46.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAGG*CAC (   1) MLPS  -8.48 deficit   5.09 prct   0.00 CutScore  46.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50             CGGG*CAG (   1) MLPS  -8.49 deficit   5.10 prct   0.00 CutScore  46.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCU*GCG (   1) MLPS  -8.58 deficit   5.20 prct   0.00 CutScore  45.25;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AAAG*CGU (   1) MLPS  -8.74 deficit   5.35 prct   0.00 CutScore  43.67;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AAAG*CGU (   1) MLPS  -8.74 deficit   5.35 prct   0.00 CutScore  43.67;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUGAG*CUC (   1) MLPS  -8.93 deficit   5.54 prct   0.00 CutScore  41.65;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUGAG*CUC (   1) MLPS  -8.93 deficit   5.54 prct   0.00 CutScore  41.65;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*GAU (   1) MLPS  -9.38 deficit   5.99 prct   0.00 CutScore  36.92;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*GAU (   1) MLPS  -9.38 deficit   5.99 prct   0.00 CutScore  36.92;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CUGC*GAG (   1) MLPS  -9.67 deficit   6.28 prct   0.00 CutScore  33.85;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GCCG*CAC (   1) MLPS  -9.75 deficit   6.36 prct   0.00 CutScore  33.04;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CUAC*GAG (   1) MLPS  -9.86 deficit   6.48 prct   0.00 CutScore  31.79;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AGUG*CAU (   1) MLPS  -9.96 deficit   6.58 prct   0.00 CutScore  30.76;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AUC*GUUU (   1) MLPS -10.15 deficit   6.76 prct   0.00 CutScore  28.82;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CAGG*UAG (   1) MLPS -10.24 deficit   6.85 prct   0.00 CutScore  27.86;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GACG*UAC (   1) MLPS -10.40 deficit   7.01 prct   0.00 CutScore  26.19;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GUG*UUUC (   1) MLPS -11.08 deficit   7.70 prct   0.00 CutScore  18.94;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCGAG*CUC (   1) MLPS -11.16 deficit   7.78 prct   0.00 CutScore  18.14;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCGAG*CUC (   1) MLPS -11.16 deficit   7.78 prct   0.00 CutScore  18.14;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCGAG*CUC (   1) MLPS -11.16 deficit   7.78 prct   0.00 CutScore  18.14;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AUUC*GGU (   1) MLPS -11.56 deficit   8.18 prct   0.00 CutScore  13.88;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50             AGUG*CGU (   1) MLPS -11.72 deficit   8.33 prct   0.00 CutScore  12.28;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GGUG (   1) MLPS -12.62 deficit   9.24 prct   0.00 CutScore   2.74;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50            AUG*UGCAU (   1) MLPS -14.86 deficit  11.47 prct   0.00 CutScore -20.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50            AUG*UGCAU (   1) MLPS -14.86 deficit  11.47 prct   0.00 CutScore -20.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50            AUG*UGCAU (   1) MLPS -14.86 deficit  11.47 prct   0.00 CutScore -20.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW

Model IL_47174.11 was the best-scoring model for  219 sequences (100.0%) cWW-cWW-cWW <-- correct model

Group 173 is from IL_63133.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63133.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33              GCC*GCC (   1) MLPS  -3.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW

Model IL_63133.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-cWW <-- correct model

Group 244 is from IL_90459.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90459.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CAA*UCAG (   1) MLPS  -7.21 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GAUG (   1) MLPS  -7.38 deficit   0.17 prct   0.00 CutScore  98.20;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GAUG (   1) MLPS  -7.38 deficit   0.17 prct   0.00 CutScore  98.20;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CGC*GAUG (   1) MLPS  -7.38 deficit   0.17 prct   0.00 CutScore  98.20;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUG*CCG (   1) MLPS  -8.19 deficit   0.98 prct   0.00 CutScore  89.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUA*UUAAGC (   1) MLPS  -9.52 deficit   2.31 prct   0.00 CutScore  75.66;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUC*GUGAG (   1) MLPS  -9.73 deficit   2.52 prct   0.00 CutScore  73.49;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUG*UUAUC (   1) MLPS -10.35 deficit   3.14 prct   0.00 CutScore  66.96;  Ed  0, 0 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUA*UUCAGC (   1) MLPS -10.82 deficit   3.61 prct   0.00 CutScore  61.99;  Ed  0, 0 matches the original group, cWW-cWW-cWW

Model IL_90459.3 was the best-scoring model for    9 sequences (100.0%) cWW-cWW-cWW <-- correct model

Group   4 is from IL_02809.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02809.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -6.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -6.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -6.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -6.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GAAA*UCCUGC (   1) MLPS  -7.49 deficit   1.25 prct   0.00 CutScore  90.30;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GAAA*UCCUGC (   1) MLPS  -7.49 deficit   1.25 prct   0.00 CutScore  90.30;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GAAA*UCCUGC (   1) MLPS  -7.49 deficit   1.25 prct   0.00 CutScore  90.30;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GAAA*UCCUGC (   1) MLPS  -7.49 deficit   1.25 prct   0.00 CutScore  90.30;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GGAA*UCCAGC (   1) MLPS -10.14 deficit   3.89 prct   0.00 CutScore  69.67;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW

Model IL_02809.3 was the best-scoring model for    9 sequences (100.0%) cWW-cWW-cWW-cWW <-- correct model

Group  81 is from IL_30381.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_30381.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -6.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUAAG*UAUC (   1) MLPS  -7.93 deficit   1.93 prct   0.00 CutScore  84.49;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW

Model IL_30381.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-cWW-cWW <-- correct model

Group 114 is from IL_41766.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41766.6
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUUA*UUUC (   1) MLPS  -6.30 deficit   0.25 prct   0.00 CutScore  97.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUUA*UUUC (   1) MLPS  -6.30 deficit   0.25 prct   0.00 CutScore  97.37;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUA*UUUG (   1) MLPS  -6.38 deficit   0.33 prct   0.00 CutScore  96.51;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUA*UUUG (   1) MLPS  -6.38 deficit   0.33 prct   0.00 CutScore  96.51;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCG*CUUC (   1) MLPS  -6.74 deficit   0.69 prct   0.00 CutScore  92.72;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCG*CUUC (   1) MLPS  -6.74 deficit   0.69 prct   0.00 CutScore  92.72;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCG*CUUC (   1) MLPS  -6.74 deficit   0.69 prct   0.00 CutScore  92.72;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCG*CUUC (   1) MLPS  -6.74 deficit   0.69 prct   0.00 CutScore  92.72;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GAAG*CGGC (   1) MLPS  -7.24 deficit   1.18 prct   0.00 CutScore  87.55;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACG*CAGC (   1) MLPS  -7.25 deficit   1.20 prct   0.00 CutScore  87.39;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCU*AUUC (   1) MLPS  -7.31 deficit   1.26 prct   0.00 CutScore  86.78;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   1 Score 0.50            AAUA*UUCU (   1) MLPS  -7.31 deficit   1.26 prct   0.00 CutScore  86.76;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.49 deficit   1.43 prct   0.00 CutScore  84.90;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.49 deficit   1.43 prct   0.00 CutScore  84.90;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.49 deficit   1.43 prct   0.00 CutScore  84.90;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.49 deficit   1.43 prct   0.00 CutScore  84.90;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUG*CUCA (   1) MLPS  -7.58 deficit   1.53 prct   0.00 CutScore  83.92;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUCG*CACG (   1) MLPS  -7.73 deficit   1.68 prct   0.00 CutScore  82.32;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUA*UUCU (   1) MLPS  -7.83 deficit   1.77 prct   0.00 CutScore  81.34;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUA*UUCU (   1) MLPS  -7.83 deficit   1.77 prct   0.00 CutScore  81.34;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -8.22 deficit   2.17 prct   0.00 CutScore  77.21;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -8.22 deficit   2.17 prct   0.00 CutScore  77.21;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -8.22 deficit   2.17 prct   0.00 CutScore  77.21;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UACA*UUGA (   1) MLPS  -8.28 deficit   2.23 prct   0.00 CutScore  76.52;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGUC*GGAC (   1) MLPS  -8.31 deficit   2.26 prct   0.00 CutScore  76.26;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UCUG*CCUA (   1) MLPS  -8.65 deficit   2.60 prct   0.00 CutScore  72.62;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUAU*AGAC (   1) MLPS  -8.75 deficit   2.69 prct   0.00 CutScore  71.64;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AGUU*AGAU (   1) MLPS  -8.95 deficit   2.90 prct   0.00 CutScore  69.47;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCAG*CCAG (   1) MLPS  -8.96 deficit   2.91 prct   0.00 CutScore  69.39;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUGA*UACA (   1) MLPS  -8.99 deficit   2.94 prct   0.00 CutScore  69.04;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            ACCC*GACU (   1) MLPS  -9.61 deficit   3.56 prct   0.00 CutScore  62.57;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            ACCC*GACU (   1) MLPS  -9.61 deficit   3.56 prct   0.00 CutScore  62.57;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCAC*GGAU (   1) MLPS  -9.75 deficit   3.70 prct   0.00 CutScore  61.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCAC*GGAU (   1) MLPS  -9.75 deficit   3.70 prct   0.00 CutScore  61.05;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   4 Score 0.20           AAAAG*CGCU (   1) MLPS -10.04 deficit   3.98 prct   0.00 CutScore  58.07;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           CAAG*CGGGG (   1) MLPS -11.02 deficit   4.97 prct   0.00 CutScore  47.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAAUU*AGCC (   1) MLPS -11.12 deficit   5.07 prct   0.00 CutScore  46.63;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAAUU*AGCC (   1) MLPS -11.12 deficit   5.07 prct   0.00 CutScore  46.63;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           CAAA*UGGGG (   1) MLPS -11.35 deficit   5.30 prct   0.00 CutScore  44.21;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           CCUGC*GAAG (   1) MLPS -12.08 deficit   6.03 prct   0.00 CutScore  36.51;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           UAGAG*UGGA (   1) MLPS -12.98 deficit   6.93 prct   0.00 CutScore  27.06;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUUUU*GGAC (   1) MLPS -13.42 deficit   7.37 prct   0.00 CutScore  22.40;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUUUU*GGAC (   1) MLPS -13.42 deficit   7.37 prct   0.00 CutScore  22.40;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAGAG*UGGU (   1) MLPS -13.78 deficit   7.72 prct   0.00 CutScore  18.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAGAG*UGGU (   1) MLPS -13.78 deficit   7.72 prct   0.00 CutScore  18.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GAGAG*UGGU (   1) MLPS -13.78 deficit   7.72 prct   0.00 CutScore  18.69;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          GGUAAA*UGCC (   1) MLPS -13.86 deficit   7.81 prct   0.00 CutScore  17.82;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW

Model IL_41766.6 was the best-scoring model for   54 sequences (100.0%) cWW-cWW-cWW-cWW <-- correct model

Group 219 is from IL_82601.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82601.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   2 Score 0.33            UUCG*UUCG (   1) MLPS  -3.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW

Model IL_82601.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-cWW-cWW <-- correct model

Group 208 is from IL_79955.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_79955.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWW-cWW-cWW-cSW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGAAUU*AGGAAC (   1) MLPS  -7.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00        AGAAUU*AGGAAU (   1) MLPS  -7.53 deficit   0.08 prct   0.00 CutScore  99.52;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW-cSW-cWW
Better:   0 Equal:   0 Score 1.00      GGAGUCAC*GAAAAC (   1) MLPS -15.10 deficit   7.64 prct   0.00 CutScore  52.21;  Ed  0, 0 matches the original group, cWW-cWW-cWW-cWW-cSW-cWW

Model IL_79955.2 was the best-scoring model for    3 sequences (100.0%) cWW-cWW-cWW-cWW-cSW-cWW <-- correct model

Group 269 is from IL_97509.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97509.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-cWW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUAUU*AGGAC (   1) MLPS  -7.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00         UCAAA*UGACAA (   1) MLPS  -8.73 deficit   1.65 prct   0.00 CutScore  87.64;  Ed  0, 0 matches the original group, cWW-cWW-cWW-tHS-cWW

Model IL_97509.1 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-cWW-tHS-cWW <-- correct model

Group 266 is from IL_97191.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97191.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cWW-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UUAGUAC*GGAAUA (   1) MLPS  -4.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tHH-cSH-tWH-tHS-cWW

Model IL_97191.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-tHH-cSH-tWH-tHS-cWW <-- correct model

Group 198 is from IL_76095.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76095.3
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-cWW-tSH-R-tHW-tHW-tWH-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUAUAUUACC (   1) MLPS -10.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-R-tHW-tHW-tWH-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUACAUUACC (   1) MLPS -10.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-R-tHW-tHW-tWH-L-cWW-cWW

Model IL_76095.3 was the best-scoring model for    2 sequences (100.0%) cWW-cWW-tSH-R-tHW-tHW-tWH-L-cWW-cWW <-- correct model

Group 225 is from IL_85647.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85647.3
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACUG (   1) MLPS  -7.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACUG (   1) MLPS  -7.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAU*AGAACUG (   1) MLPS  -7.26 deficit   0.17 prct   0.00 CutScore  99.15;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUAAGUAC*GGAACUG (   1) MLPS  -7.44 deficit   0.35 prct   0.00 CutScore  98.29;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUGAGUAA*UGAAAUU (   1) MLPS  -7.65 deficit   0.56 prct   0.00 CutScore  97.21;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUGAGUAA*UGAAAUU (   1) MLPS  -7.65 deficit   0.56 prct   0.00 CutScore  97.21;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUAAGUAA*UGAAAUU (   1) MLPS  -8.10 deficit   1.01 prct   0.00 CutScore  94.99;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACCG (   1) MLPS  -8.67 deficit   1.58 prct   0.00 CutScore  92.21;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAU*AGAACCG (   1) MLPS  -8.84 deficit   1.75 prct   0.00 CutScore  91.36;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAU*AGAACCG (   1) MLPS  -8.84 deficit   1.75 prct   0.00 CutScore  91.36;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUUAGUAC*GGAACAG (   1) MLPS  -9.24 deficit   2.15 prct   0.00 CutScore  89.37;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     GUUAGUAG*CGAACCC (   1) MLPS  -9.32 deficit   2.23 prct   0.00 CutScore  88.95;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     GUUAGUAC*GGAACAC (   1) MLPS  -9.47 deficit   2.38 prct   0.00 CutScore  88.23;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CCCAGUAA*UGAACAG (   1) MLPS  -9.70 deficit   2.61 prct   0.00 CutScore  87.11;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     GUUAGUAC*GGAAGUC (   1) MLPS  -9.78 deficit   2.69 prct   0.00 CutScore  86.71;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    ACCGAGUAG*CGAAACU (   1) MLPS -12.65 deficit   5.56 prct   0.00 CutScore  72.50;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW

Model IL_85647.3 was the best-scoring model for   16 sequences (100.0%) cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW <-- correct model

Group 254 is from IL_92321.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92321.4
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWW-tSH-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AUGAAG*CGGAUU (   1) MLPS  -7.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        AUGAAG*CGGAUU (   1) MLPS  -7.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UUGAAC*GGGAUA (   1) MLPS  -7.69 deficit   0.10 prct   0.00 CutScore  99.35;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        CUGAUG*CGGAUG (   1) MLPS  -7.89 deficit   0.30 prct   0.00 CutScore  98.14;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UUCAAC*GGGAUA (   1) MLPS  -8.10 deficit   0.51 prct   0.00 CutScore  96.82;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GGGAAG*CAGAAC (   1) MLPS -11.84 deficit   4.25 prct   0.00 CutScore  73.55;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GUGAAG*UGGAAGC (   1) MLPS -13.25 deficit   5.66 prct   0.00 CutScore  64.78;  Ed  0, 0 matches the original group, cWW-cWW-tSH-tHS-tHS-cWW

Model IL_92321.4 was the best-scoring model for    7 sequences (100.0%) cWW-cWW-tSH-tHS-tHS-cWW <-- correct model

Group 265 is from IL_97057.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97057.3
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-tWH-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAUAAC*GGAAGC (   1) MLPS  -6.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAC*GGAAGC (   1) MLPS  -6.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAG*CGAAAC (   1) MLPS  -6.54 deficit   0.10 prct   0.00 CutScore  99.36;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GGUAAG*CGAAAC (   1) MLPS  -6.77 deficit   0.33 prct   0.00 CutScore  97.79;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAG*CGAUAC (   1) MLPS  -7.63 deficit   1.19 prct   0.00 CutScore  92.07;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00         ACGAAU*AGACU (   1) MLPS -12.96 deficit   6.52 prct   0.00 CutScore  56.74;  Ed  0, 0 matches the original group, cWW-cWW-tWH-L-tHS-cWW

Model IL_97057.3 was the best-scoring model for    6 sequences (100.0%) cWW-cWW-tWH-L-tHS-cWW <-- correct model

Group  67 is from IL_25271.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25271.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-tWH-tWH-tHW-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GGAUAAC*GCUAAUAC (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW
Better:   0 Equal:   0 Score 1.00     GGAUAAC*GCUAAUAC (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW
Better:   0 Equal:   0 Score 1.00     GUAUAAC*GCUAAUAC (   1) MLPS  -6.61 deficit   1.03 prct   0.00 CutScore  95.08;  Ed  0, 0 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW

Model IL_25271.2 was the best-scoring model for    3 sequences (100.0%) cWW-cWW-tWH-tWH-tHW-tHW-cWW <-- correct model

Group 222 is from IL_83856.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83856.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWW-tWW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GCUAAC*GCGAAC (   1) MLPS  -7.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-cWW-tWW-tHS-cWW-cWW

Model IL_83856.1 was the best-scoring model for    1 sequences (100.0%) cWW-cWW-tWW-tHS-cWW-cWW <-- correct model

Group  69 is from IL_25307.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25307.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tHH-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAAGC*GAAA (   1) MLPS  -6.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHH-L-R-L-cWW

Model IL_25307.1 was the best-scoring model for    1 sequences (100.0%) cWW-tHH-L-R-L-cWW <-- correct model

Group 103 is from IL_39199.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39199.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-tHS-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50               UG*UAA (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               UG*UAA (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               UG*UAA (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               UG*CAA (   1) MLPS  -3.47 deficit   0.04 prct   0.00 CutScore  99.60;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               UG*CAA (   1) MLPS  -3.47 deficit   0.04 prct   0.00 CutScore  99.60;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -3.73 deficit   0.30 prct   0.00 CutScore  96.86;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -3.73 deficit   0.30 prct   0.00 CutScore  96.86;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UAC (   1) MLPS  -3.73 deficit   0.30 prct   0.00 CutScore  96.86;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -3.77 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -3.77 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               GG*CAC (   1) MLPS  -3.77 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   3 Score 0.25               GC*GAC (   1) MLPS  -3.85 deficit   0.41 prct   0.00 CutScore  95.65;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               GC*GGC (   1) MLPS  -3.87 deficit   0.43 prct   0.00 CutScore  95.46;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               UG*UGA (   1) MLPS  -3.93 deficit   0.50 prct   0.00 CutScore  94.76;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               UG*UGA (   1) MLPS  -3.93 deficit   0.50 prct   0.00 CutScore  94.76;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               UG*UGA (   1) MLPS  -3.93 deficit   0.50 prct   0.00 CutScore  94.76;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GA*UAC (   1) MLPS  -4.11 deficit   0.67 prct   0.00 CutScore  92.92;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UUC (   1) MLPS  -4.49 deficit   1.06 prct   0.00 CutScore  88.87;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*CUC (   1) MLPS  -4.53 deficit   1.09 prct   0.00 CutScore  88.48;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*CUC (   1) MLPS  -4.53 deficit   1.09 prct   0.00 CutScore  88.48;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*CUC (   1) MLPS  -4.53 deficit   1.09 prct   0.00 CutScore  88.48;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               GC*GUC (   1) MLPS  -4.61 deficit   1.17 prct   0.00 CutScore  87.67;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GA*UUC (   1) MLPS  -4.87 deficit   1.43 prct   0.00 CutScore  84.94;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UG*UAAA (   1) MLPS  -4.91 deficit   1.48 prct   0.00 CutScore  84.44;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GAAA (   1) MLPS  -5.03 deficit   1.59 prct   0.00 CutScore  83.24;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GAAA (   1) MLPS  -5.03 deficit   1.59 prct   0.00 CutScore  83.24;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UCC (   1) MLPS  -5.09 deficit   1.66 prct   0.00 CutScore  82.56;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*UCC (   1) MLPS  -5.09 deficit   1.66 prct   0.00 CutScore  82.56;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*CCC (   1) MLPS  -5.13 deficit   1.69 prct   0.00 CutScore  82.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50               GG*CCC (   1) MLPS  -5.13 deficit   1.69 prct   0.00 CutScore  82.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   4 Score 0.20               CG*UAG (   1) MLPS  -5.15 deficit   1.71 prct   0.00 CutScore  82.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -5.18 deficit   1.75 prct   0.00 CutScore  81.61;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -5.18 deficit   1.75 prct   0.00 CutScore  81.61;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   4 Score 0.20               CG*CAG (   1) MLPS  -5.18 deficit   1.75 prct   0.00 CutScore  81.61;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GGAA (   1) MLPS  -5.53 deficit   2.09 prct   0.00 CutScore  78.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GGAA (   1) MLPS  -5.53 deficit   2.09 prct   0.00 CutScore  78.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GGAA (   1) MLPS  -5.53 deficit   2.09 prct   0.00 CutScore  78.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GGAA (   1) MLPS  -5.53 deficit   2.09 prct   0.00 CutScore  78.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              UC*GGAA (   1) MLPS  -5.53 deficit   2.09 prct   0.00 CutScore  78.00;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GA*UGAC (   1) MLPS  -5.60 deficit   2.17 prct   0.00 CutScore  77.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GA*UGAC (   1) MLPS  -5.60 deficit   2.17 prct   0.00 CutScore  77.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GA*UGAC (   1) MLPS  -5.60 deficit   2.17 prct   0.00 CutScore  77.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GA*UGAC (   1) MLPS  -5.60 deficit   2.17 prct   0.00 CutScore  77.17;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -5.92 deficit   2.49 prct   0.00 CutScore  73.84;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               UC*GUA (   1) MLPS  -5.92 deficit   2.49 prct   0.00 CutScore  73.84;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -6.28 deficit   2.85 prct   0.00 CutScore  70.05;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -6.28 deficit   2.85 prct   0.00 CutScore  70.05;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   3 Score 0.25               CG*UGG (   1) MLPS  -6.28 deficit   2.85 prct   0.00 CutScore  70.05;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GG*CAUC (   1) MLPS  -6.35 deficit   2.91 prct   0.00 CutScore  69.34;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GG*CAUC (   1) MLPS  -6.35 deficit   2.91 prct   0.00 CutScore  69.34;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   0 Score 1.00               GA*UGU (   1) MLPS  -6.57 deficit   3.13 prct   0.00 CutScore  67.06;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   1 Score 0.50              AC*GGUU (   1) MLPS  -8.26 deficit   4.83 prct   0.00 CutScore  49.18;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW
Better:   0 Equal:   2 Score 0.33               UG*UUG (   1) MLPS  -9.86 deficit   6.43 prct   0.00 CutScore  32.36;  Ed  0, 0 matches the original group, cWW-tHS-cSH-cWW

Model IL_39199.4 was the best-scoring model for   53 sequences (100.0%) cWW-tHS-cSH-cWW <-- correct model

Group  32 is from IL_12147.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12147.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             UAAC*GAG (   1) MLPS  -6.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   1 Score 0.50              ACA*UUU (   1) MLPS  -6.19 deficit   0.09 prct   0.00 CutScore  99.06;  Ed  0, 0 matches the original group, cWW-tHS-cWW

Model IL_12147.1 was the best-scoring model for    2 sequences (100.0%) cWW-tHS-cWW <-- correct model

Group  97 is from IL_37104.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37104.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50             CAG*CGGG (   1) MLPS  -6.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   1 Score 0.50             CAG*CGGG (   1) MLPS  -6.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             CAG*UGGG (   1) MLPS  -6.63 deficit   0.40 prct   0.00 CutScore  95.81;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UAG*CGGG (   1) MLPS  -6.76 deficit   0.53 prct   0.00 CutScore  94.44;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UAG*UGGG (   1) MLPS  -7.16 deficit   0.93 prct   0.00 CutScore  90.25;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UAG*UGGG (   1) MLPS  -7.16 deficit   0.93 prct   0.00 CutScore  90.25;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   2 Score 0.33            CAG*CGAAG (   1) MLPS  -7.87 deficit   1.64 prct   0.00 CutScore  82.77;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAG*CGUAG (   1) MLPS  -8.32 deficit   2.09 prct   0.00 CutScore  78.01;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAA*UGUAG (   1) MLPS  -8.57 deficit   2.34 prct   0.00 CutScore  75.38;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAU*AGUAG (   1) MLPS  -8.58 deficit   2.35 prct   0.00 CutScore  75.23;  Ed  0, 0 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             CUAC*GGG (   1) MLPS -10.28 deficit   4.05 prct   0.00 CutScore  57.40;  Ed  0, 0 matches the original group, cWW-tHS-cWW

Model IL_37104.3 was the best-scoring model for   11 sequences (100.0%) cWW-tHS-cWW <-- correct model

Group  17 is from IL_06421.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06421.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AAU*AGGUU (   1) MLPS  -6.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-tHS-cWW

Model IL_06421.1 was the best-scoring model for    1 sequences (100.0%) cWW-tHS-tHS-cWW <-- correct model

Group 154 is from IL_54470.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54470.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAGU*GGGGG (   1) MLPS  -5.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHS-tHS-cWW

Model IL_54470.1 was the best-scoring model for    1 sequences (100.0%) cWW-tHS-tHS-cWW <-- correct model

Group 199 is from IL_76263.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76263.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-tHW-L-R-R-R-L-L-L-L-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AGACGGCACCC*GAAGGCAU (   1) MLPS -12.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-L-R-R-R-L-L-L-L-L-L-L-cWW

Model IL_76263.1 was the best-scoring model for    1 sequences (100.0%) cWW-tHW-L-R-R-R-L-L-L-L-L-L-L-cWW <-- correct model

Group 233 is from IL_87507.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87507.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tHW-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUGAC*GGUG (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GAUAG*CGUCC (   1) MLPS  -7.83 deficit   0.94 prct   0.00 CutScore  92.41;  Ed  0, 0 matches the original group, cWW-tHW-L-tHS-cWW

Model IL_87507.1 was the best-scoring model for    2 sequences (100.0%) cWW-tHW-L-tHS-cWW <-- correct model

Group   8 is from IL_03282.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_03282.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tHW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAGGU*AAGUC (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tHW-tHS-cWW-cWW

Model IL_03282.1 was the best-scoring model for    1 sequences (100.0%) cWW-tHW-tHS-cWW-cWW <-- correct model

Group   7 is from IL_03110.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_03110.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-L-L-L-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CUCUCAUC*GUGCG (   1) MLPS  -9.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-L-L-tHS-cWW-cWW

Model IL_03110.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-L-L-tHS-cWW-cWW <-- correct model

Group 119 is from IL_43316.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43316.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-L-L-tHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UGUGCG*UUAAG (   1) MLPS  -5.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-L-tHH-cWW

Model IL_43316.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-L-tHH-cWW <-- correct model

Group 207 is from IL_79083.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_79083.3
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-L-R-L-tHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UGUAAG*UUGAG (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHH-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*UUGAG (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHH-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*CUGAG (   1) MLPS  -5.29 deficit   0.63 prct   0.00 CutScore  96.49;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHH-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*CUGAG (   1) MLPS  -5.29 deficit   0.63 prct   0.00 CutScore  96.49;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHH-cWW
Better:   0 Equal:   0 Score 1.00         UGCACG*UUCAG (   1) MLPS  -7.49 deficit   2.83 prct   0.00 CutScore  84.20;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHH-cWW

Model IL_79083.3 was the best-scoring model for    5 sequences (100.0%) cWW-tSH-L-R-L-tHH-cWW <-- correct model

Group 164 is from IL_57977.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57977.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-L-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CUUGAA*UGGCG (   1) MLPS  -8.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-L-tHS-cWW

Model IL_57977.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-R-L-tHS-cWW <-- correct model

Group 214 is from IL_80714.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80714.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-L-R-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGAACCG*CAAAA (   1) MLPS  -7.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-L-L-L-cWW

Model IL_80714.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-R-R-L-L-L-cWW <-- correct model

Group  72 is from IL_26971.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26971.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-L-R-R-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UCUUC*GGAAUA (   1) MLPS  -7.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-R-L-cWW

Model IL_26971.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-R-R-R-L-cWW <-- correct model

Group 216 is from IL_82188.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82188.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-L-R-R-R-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGAACAC*GACGAAG (   1) MLPS -10.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-R-R-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00      UCAAAGU*AACCAAG (   1) MLPS -10.90 deficit   0.10 prct   0.00 CutScore  99.44;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-R-R-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00      AAAAAUG*CGCCAAU (   1) MLPS -11.79 deficit   0.99 prct   0.00 CutScore  94.40;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-R-R-L-L-L-cWW
Better:   0 Equal:   0 Score 1.00      CGACCAG*CUCUUAG (   1) MLPS -13.39 deficit   2.60 prct   0.00 CutScore  85.34;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-R-R-L-L-L-cWW

Model IL_82188.2 was the best-scoring model for    4 sequences (100.0%) cWW-tSH-L-R-R-R-R-L-L-L-cWW <-- correct model

Group 166 is from IL_58454.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58454.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tSH-L-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUUCC*GGUAG (   1) MLPS  -5.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-L-R-R-cWW

Model IL_58454.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-L-R-R-cWW <-- correct model

Group 184 is from IL_69536.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69536.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGUUC*GGUAG (   1) MLPS  -6.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UCUCC*GGUAG (   1) MLPS  -6.85 deficit   0.77 prct   0.00 CutScore  95.10;  Ed  0, 0 matches the original group, cWW-tSH-R-R-cWW

Model IL_69536.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-R-R-cWW <-- correct model

Group  45 is from IL_17603.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17603.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-R-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGAAG*UGACAAC (   1) MLPS  -6.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHH-tHS-cWW

Model IL_17603.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-R-tHH-tHS-cWW <-- correct model

Group 255 is from IL_93424.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_93424.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tSH-R-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGAAG*CUAAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CUAAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CUAAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CUAAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CUAAG (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   1 Score 0.50          CGAUG*CUAAG (   1) MLPS  -6.45 deficit   1.04 prct   0.00 CutScore  90.80;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   1 Score 0.50          CGAUG*CUAAG (   1) MLPS  -6.45 deficit   1.04 prct   0.00 CutScore  90.80;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          UGAUG*CUAAA (   1) MLPS  -6.98 deficit   1.56 prct   0.00 CutScore  86.12;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00         CGAAAG*CUAAG (   1) MLPS  -7.75 deficit   2.33 prct   0.00 CutScore  79.29;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          AGAAU*AUUAU (   1) MLPS  -7.86 deficit   2.45 prct   0.00 CutScore  78.25;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          AGAAU*AUUAU (   1) MLPS  -7.86 deficit   2.45 prct   0.00 CutScore  78.25;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          CGAGA*UUAAG (   1) MLPS  -8.24 deficit   2.83 prct   0.00 CutScore  74.85;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          UGCAG*CCAAG (   1) MLPS  -8.47 deficit   3.05 prct   0.00 CutScore  72.90;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00           UGGU*AGAAG (   1) MLPS  -9.07 deficit   3.66 prct   0.00 CutScore  67.55;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00        CGAAAUG*CUAAG (   1) MLPS  -9.27 deficit   3.86 prct   0.00 CutScore  65.72;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00         CAAAAG*CUAAG (   1) MLPS  -9.77 deficit   4.36 prct   0.00 CutScore  61.28;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00           UGAC*GGAAG (   1) MLPS -10.04 deficit   4.63 prct   0.00 CutScore  58.93;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00          UGUAC*GGUAG (   1) MLPS -10.87 deficit   5.46 prct   0.00 CutScore  51.51;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00        CGAACCU*AUAAG (   1) MLPS -12.25 deficit   6.83 prct   0.00 CutScore  39.34;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00           GGGG*UGCAC (   1) MLPS -12.88 deficit   7.47 prct   0.00 CutScore  33.68;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00         UUUUUG*CGAAG (   1) MLPS -14.74 deficit   9.33 prct   0.00 CutScore  17.17;  Ed  0, 0 matches the original group, cWW-tSH-R-tHW-cWW

Model IL_93424.4 was the best-scoring model for   21 sequences (100.0%) cWW-tSH-R-tHW-cWW <-- correct model

Group 143 is from IL_50521.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_50521.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-cWH-tWH-tSS-tHW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UGAAGAAG*UGUAAAG (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWH-tWH-tSS-tHW-L-cWW
Better:   0 Equal:   0 Score 1.00     GGAAGAAG*UGUAAAC (   1) MLPS  -7.26 deficit   0.37 prct   0.00 CutScore  98.15;  Ed  0, 0 matches the original group, cWW-tSH-cWH-tWH-tSS-tHW-L-cWW

Model IL_50521.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-cWH-tWH-tSS-tHW-L-cWW <-- correct model

Group 130 is from IL_46648.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46648.6
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-tSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              CAAG*UG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50              CAAG*UG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50              CAAG*UG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50              CAAG*UG (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   0 Score 1.00              UAAG*UA (   1) MLPS  -3.84 deficit   0.25 prct   0.00 CutScore  97.32;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   0 Score 1.00              AACG*UU (   1) MLPS  -5.25 deficit   1.67 prct   0.00 CutScore  82.39;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50               GUG*CC (   1) MLPS  -5.91 deficit   2.33 prct   0.00 CutScore  75.44;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50               AUG*CU (   1) MLPS  -6.04 deficit   2.46 prct   0.00 CutScore  74.11;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50               CUA*UG (   1) MLPS  -6.14 deficit   2.56 prct   0.00 CutScore  73.03;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   2 Score 0.33               GUA*UC (   1) MLPS  -6.22 deficit   2.64 prct   0.00 CutScore  72.18;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   1 Score 0.50              CAAG*CG (   1) MLPS  -6.28 deficit   2.69 prct   0.00 CutScore  71.63;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   3 Score 0.25               GAC*GC (   1) MLPS  -6.94 deficit   3.35 prct   0.00 CutScore  64.69;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   0 Score 1.00              GAUU*AC (   1) MLPS  -7.74 deficit   4.16 prct   0.00 CutScore  56.21;  Ed  0, 0 matches the original group, cWW-tSH-cWW

Model IL_46648.6 was the best-scoring model for   13 sequences (100.0%) cWW-tSH-cWW <-- correct model

Group 180 is from IL_67887.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_67887.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-tSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GG*UUGAU (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW
Better:   0 Equal:   0 Score 1.00              AG*UAAU (   1) MLPS  -6.02 deficit   0.54 prct   0.00 CutScore  94.30;  Ed  0, 0 matches the original group, cWW-tSH-cWW

Model IL_67887.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-cWW <-- correct model

Group 162 is from IL_57364.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57364.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-cWW-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUG*CCAAU (   1) MLPS  -5.21 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-cWW-R-cWW

Model IL_57364.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-cWW-R-cWW <-- correct model

Group 182 is from IL_68827.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68827.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tHH-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAG*CACAAAC (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHH-R-R-R-cWW

Model IL_68827.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tHH-R-R-R-cWW <-- correct model

Group 262 is from IL_95652.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95652.3
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-tHH-cSH-tWH-tHS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGAGUACG*UGAAAC (   1) MLPS  -6.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00      GGAGUAUG*UGAAAC (   1) MLPS  -6.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00      GAAGUAUG*UGAAAC (   1) MLPS  -6.67 deficit   0.20 prct   0.00 CutScore  98.99;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00      GGAGUACG*UAAAAC (   1) MLPS  -7.28 deficit   0.81 prct   0.00 CutScore  95.93;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-L-cWW

Model IL_95652.3 was the best-scoring model for    4 sequences (100.0%) cWW-tSH-tHH-cSH-tWH-tHS-L-cWW <-- correct model

Group 140 is from IL_49493.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49493.4
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GUAGUAG*CGAACC (   1) MLPS  -6.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       AUAGUAC*GGAACU (   1) MLPS  -7.01 deficit   0.04 prct   0.00 CutScore  99.78;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CCAGUAG*CGAACG (   1) MLPS  -7.23 deficit   0.26 prct   0.00 CutScore  98.57;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GGAGUAC*GGAAAC (   1) MLPS  -7.26 deficit   0.29 prct   0.00 CutScore  98.41;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   1 Score 0.50       CUAGUAC*GGACCG (   1) MLPS  -7.34 deficit   0.38 prct   0.00 CutScore  97.96;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   1 Score 0.50       CUAGUAC*GGACCG (   1) MLPS  -7.34 deficit   0.38 prct   0.00 CutScore  97.96;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   1 Score 0.50       CUAGUAC*GGACCG (   1) MLPS  -7.34 deficit   0.38 prct   0.00 CutScore  97.96;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GUAGUAG*CGAAAC (   1) MLPS  -7.43 deficit   0.46 prct   0.00 CutScore  97.49;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CCAGUAA*UGACCG (   1) MLPS  -7.87 deficit   0.90 prct   0.00 CutScore  95.09;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UUAGUAA*UGAACG (   1) MLPS  -7.88 deficit   0.91 prct   0.00 CutScore  95.04;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAGUAG*CGAAAG (   1) MLPS  -8.08 deficit   1.12 prct   0.00 CutScore  93.92;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       AUAGUAG*UGAACU (   1) MLPS  -8.40 deficit   1.44 prct   0.00 CutScore  92.17;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAGUAU*AAAAAA (   1) MLPS  -9.40 deficit   2.43 prct   0.00 CutScore  86.78;  Ed  0, 0 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW

Model IL_49493.4 was the best-scoring model for   13 sequences (100.0%) cWW-tSH-tHH-cSH-tWH-tHS-cWW <-- correct model

Group 209 is from IL_80093.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80093.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UUAAC*GGCAGA (   1) MLPS  -9.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CGAAC*GCAUAG (   1) MLPS -10.34 deficit   0.41 prct   0.00 CutScore  96.75;  Ed  0, 0 matches the original group, cWW-tSH-tHH-tHS-cWW

Model IL_80093.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tHH-tHS-cWW <-- correct model

Group  20 is from IL_06808.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06808.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGAG*UAAAG (   1) MLPS  -6.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW

Model IL_06808.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tHS-cWW <-- correct model

Group  37 is from IL_13959.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13959.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAU*AGAG (   1) MLPS  -5.75 deficit   0.17 prct   0.00 CutScore  98.21;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAU*AGAG (   1) MLPS  -5.75 deficit   0.17 prct   0.00 CutScore  98.21;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAU*AGAG (   1) MLPS  -5.75 deficit   0.17 prct   0.00 CutScore  98.21;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAAC*GGAG (   1) MLPS  -6.17 deficit   0.58 prct   0.00 CutScore  93.86;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAAA*UGAG (   1) MLPS  -6.30 deficit   0.72 prct   0.00 CutScore  92.41;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAC*GAAG (   1) MLPS  -6.51 deficit   0.93 prct   0.00 CutScore  90.24;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UAAC*GGAA (   1) MLPS  -6.73 deficit   1.15 prct   0.00 CutScore  87.89;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UAAA*UGAA (   1) MLPS  -6.87 deficit   1.29 prct   0.00 CutScore  86.44;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GGAG (   1) MLPS  -7.02 deficit   1.44 prct   0.00 CutScore  84.88;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GGAG (   1) MLPS  -7.02 deficit   1.44 prct   0.00 CutScore  84.88;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAAC*GAAG (   1) MLPS  -7.02 deficit   1.44 prct   0.00 CutScore  84.87;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            GGAG*UGAC (   1) MLPS  -8.00 deficit   2.42 prct   0.00 CutScore  74.52;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UCAG*CAAG (   1) MLPS  -8.63 deficit   3.05 prct   0.00 CutScore  67.90;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   4 Score 0.20           CGCU*AAAAG (   1) MLPS  -9.01 deficit   3.43 prct   0.00 CutScore  63.92;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAA*UGACA (   1) MLPS  -9.54 deficit   3.96 prct   0.00 CutScore  58.35;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAC*GGAAAG (   1) MLPS -10.22 deficit   4.63 prct   0.00 CutScore  51.23;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CAAU*AGAACG (   1) MLPS -11.33 deficit   5.75 prct   0.00 CutScore  39.47;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            AAUA*UAUU (   1) MLPS -11.44 deficit   5.86 prct   0.00 CutScore  38.31;  Ed  0, 0 matches the original group, cWW-tSH-tHS-cWW

Model IL_13959.4 was the best-scoring model for   26 sequences (100.0%) cWW-tSH-tHS-cWW <-- correct model

Group 256 is from IL_93568.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_93568.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHS-tHS-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGAAGG*CUUGAG (   1) MLPS -10.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHS-tHS-L-R-cWW
Better:   0 Equal:   0 Score 1.00        CGAAGC*GUGGAG (   1) MLPS -10.82 deficit   0.05 prct   0.00 CutScore  99.65;  Ed  0, 0 matches the original group, cWW-tSH-tHS-tHS-L-R-cWW
Better:   0 Equal:   0 Score 1.00        UGAAAC*GCGGAG (   1) MLPS -10.99 deficit   0.22 prct   0.00 CutScore  98.44;  Ed  0, 0 matches the original group, cWW-tSH-tHS-tHS-L-R-cWW
Better:   0 Equal:   0 Score 1.00      UGAAAGAC*GGGGAG (   1) MLPS -13.88 deficit   3.12 prct   0.00 CutScore  78.25;  Ed  0, 0 matches the original group, cWW-tSH-tHS-tHS-L-R-cWW

Model IL_93568.2 was the best-scoring model for    4 sequences (100.0%) cWW-tSH-tHS-tHS-L-R-cWW <-- correct model

Group  83 is from IL_31006.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31006.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tHW-L-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGACCA*UCUUAG (   1) MLPS  -6.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-L-bif-cWW

Model IL_31006.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tHW-L-bif-cWW <-- correct model

Group  66 is from IL_25230.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25230.3
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  CGAUGGUAG*CGAGAGUAG (   1) MLPS  -9.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAUGGUAG*CGAGAGUAG (   1) MLPS  -9.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAUGGUAG*CGAGAGUAG (   1) MLPS  -9.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAUGGUAC*GGAGAGUAG (   1) MLPS  -9.41 deficit   0.09 prct   0.00 CutScore  99.58;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CAAUGAUAC*GAAAAGUCG (   1) MLPS -11.92 deficit   2.61 prct   0.00 CutScore  87.86;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS -13.72 deficit   4.41 prct   0.00 CutScore  79.49;  Ed  0, 0 matches the original group, cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW

Model IL_25230.3 was the best-scoring model for    6 sequences (100.0%) cWW-tSH-tHW-bif-L-R-bif-tWH-tHS-cWW <-- correct model

Group 235 is from IL_87548.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87548.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tHW-cSH-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGAAA*UAUGUAG (   1) MLPS  -7.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-cSH-tWW-cWW
Better:   0 Equal:   0 Score 1.00         GGACG*CGGUAC (   1) MLPS  -7.99 deficit   0.85 prct   0.00 CutScore  95.51;  Ed  0, 0 matches the original group, cWW-tSH-tHW-cSH-tWW-cWW

Model IL_87548.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tHW-cSH-tWW-cWW <-- correct model

Group  63 is from IL_24982.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24982.5
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAAG*CGUAG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAGG*CGUAG (   1) MLPS  -6.43 deficit   0.30 prct   0.00 CutScore  97.23;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CGUAG (   1) MLPS  -6.44 deficit   0.31 prct   0.00 CutScore  97.13;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGUAG (   1) MLPS  -6.69 deficit   0.56 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGUAG (   1) MLPS  -6.69 deficit   0.56 prct   0.00 CutScore  94.75;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAGG*UGUAG (   1) MLPS  -7.00 deficit   0.87 prct   0.00 CutScore  91.88;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAGG*UGUAG (   1) MLPS  -7.00 deficit   0.87 prct   0.00 CutScore  91.88;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CAAAG*CGUAG (   1) MLPS  -7.06 deficit   0.93 prct   0.00 CutScore  91.31;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAC*GGUCG (   1) MLPS  -7.31 deficit   1.18 prct   0.00 CutScore  88.99;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   1 Score 0.50          CGAAG*UGUAG (   1) MLPS  -7.32 deficit   1.19 prct   0.00 CutScore  88.91;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   1 Score 0.50          CAAAC*GGUAG (   1) MLPS  -7.36 deficit   1.23 prct   0.00 CutScore  88.51;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   1 Score 0.50          CAAAC*GGUAG (   1) MLPS  -7.36 deficit   1.23 prct   0.00 CutScore  88.51;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   1 Score 0.50          AAAAG*CGUAU (   1) MLPS  -7.51 deficit   1.37 prct   0.00 CutScore  87.19;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAGG*CGCAG (   1) MLPS  -7.66 deficit   1.53 prct   0.00 CutScore  85.72;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAGG*CGCAG (   1) MLPS  -7.97 deficit   1.84 prct   0.00 CutScore  82.85;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAGG*CGCAG (   1) MLPS  -8.22 deficit   2.09 prct   0.00 CutScore  80.47;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW

Model IL_24982.5 was the best-scoring model for   16 sequences (100.0%) cWW-tSH-tHW-tHS-cWW <-- correct model

Group 134 is from IL_47444.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47444.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UCAGAG*CAGCAG (   1) MLPS  -7.99 deficit   1.34 prct   0.00 CutScore  92.55;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        CCAGGU*GAGCAG (   1) MLPS  -8.41 deficit   1.77 prct   0.00 CutScore  90.20;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UACAGA*UAGGUA (   1) MLPS -14.85 deficit   8.21 prct   0.00 CutScore  54.47;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GGGAGC*GGGAGC (   1) MLPS -15.55 deficit   8.91 prct   0.00 CutScore  50.57;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        CCACAC*GCGUGG (   1) MLPS -16.66 deficit  10.01 prct   0.00 CutScore  44.44;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW

Model IL_47444.3 was the best-scoring model for    9 sequences (100.0%) cWW-tSH-tHW-tHS-cWW-cWW <-- correct model

Group  28 is from IL_09882.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09882.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHW-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGAAAG*CGAAAG (   1) MLPS -10.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UCACAG*UCACAG (   1) MLPS -11.00 deficit   0.02 prct   0.00 CutScore  99.85;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tWH-tHS-cWW

Model IL_09882.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tHW-tWH-tHS-cWW <-- correct model

Group  71 is from IL_26868.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26868.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHW-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAGG*CGUUAC (   1) MLPS  -5.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tHW-tWW-cWW

Model IL_26868.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tHW-tWW-cWW <-- correct model

Group 192 is from IL_72158.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_72158.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSH-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAGAAG (   1) MLPS  -6.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAGAAG (   1) MLPS  -6.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUACC*GAAGAAG (   1) MLPS  -7.18 deficit   0.21 prct   0.00 CutScore  98.83;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GAAGAAG (   1) MLPS  -7.27 deficit   0.29 prct   0.00 CutScore  98.34;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAUAAG (   1) MLPS  -7.56 deficit   0.59 prct   0.00 CutScore  96.68;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAUAAG (   1) MLPS  -7.56 deficit   0.59 prct   0.00 CutScore  96.68;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHH-tHS-cWW

Model IL_72158.3 was the best-scoring model for    6 sequences (100.0%) cWW-tSH-tSH-tHH-tHS-cWW <-- correct model

Group  39 is from IL_15840.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15840.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tSH-tHS-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAGCAG*CCAAG (   1) MLPS  -7.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-bif-cWW
Better:   0 Equal:   0 Score 1.00         AAGAAG*CCACU (   1) MLPS  -8.44 deficit   0.67 prct   0.00 CutScore  96.06;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-bif-cWW

Model IL_15840.2 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tSH-tHS-bif-cWW <-- correct model

Group 236 is from IL_87904.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87904.5
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGGAG*CGAAC (   1) MLPS  -7.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGGAG*CGAAG (   1) MLPS  -7.10 deficit   0.03 prct   0.00 CutScore  99.67;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGGAG*CGAAG (   1) MLPS  -7.10 deficit   0.03 prct   0.00 CutScore  99.67;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGGAG*CGAAG (   1) MLPS  -7.10 deficit   0.03 prct   0.00 CutScore  99.67;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAG*CGAAA (   1) MLPS  -7.43 deficit   0.36 prct   0.00 CutScore  96.22;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGGAG*CUAAC (   1) MLPS  -7.66 deficit   0.59 prct   0.00 CutScore  93.78;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAG*CGACC (   1) MLPS  -7.86 deficit   0.79 prct   0.00 CutScore  91.68;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAG*CGACC (   1) MLPS  -7.86 deficit   0.79 prct   0.00 CutScore  91.68;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CCAAG*CGACG (   1) MLPS  -7.89 deficit   0.82 prct   0.00 CutScore  91.34;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CCAAG*CGACG (   1) MLPS  -7.89 deficit   0.82 prct   0.00 CutScore  91.34;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AGGAA*UGAAU (   1) MLPS  -8.03 deficit   0.96 prct   0.00 CutScore  89.86;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AGGAU*AGAAU (   1) MLPS  -8.10 deficit   1.03 prct   0.00 CutScore  89.15;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGACG*CUAAC (   1) MLPS  -8.17 deficit   1.10 prct   0.00 CutScore  88.38;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGACG*CAAAC (   1) MLPS  -8.20 deficit   1.13 prct   0.00 CutScore  88.15;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGACG*CAAAC (   1) MLPS  -8.20 deficit   1.13 prct   0.00 CutScore  88.15;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGGAG*UUAAC (   1) MLPS  -8.21 deficit   1.14 prct   0.00 CutScore  88.03;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGACA (   1) MLPS  -8.22 deficit   1.15 prct   0.00 CutScore  87.90;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGGAG*UUAAG (   1) MLPS  -8.24 deficit   1.17 prct   0.00 CutScore  87.69;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGGAG*UUAAG (   1) MLPS  -8.24 deficit   1.17 prct   0.00 CutScore  87.69;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAG*UGAAG (   1) MLPS  -8.44 deficit   1.36 prct   0.00 CutScore  85.64;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAG*UGAAG (   1) MLPS  -8.44 deficit   1.36 prct   0.00 CutScore  85.64;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAG*UGAAG (   1) MLPS  -8.44 deficit   1.36 prct   0.00 CutScore  85.64;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAA*UGAAG (   1) MLPS  -8.44 deficit   1.36 prct   0.00 CutScore  85.63;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAC*GAAAA (   1) MLPS  -8.79 deficit   1.72 prct   0.00 CutScore  81.91;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CCGAG*CGGCG (   1) MLPS  -9.21 deficit   2.14 prct   0.00 CutScore  77.43;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CCGAG*CGGCG (   1) MLPS  -9.21 deficit   2.14 prct   0.00 CutScore  77.43;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50          CGUAU*AAAAG (   1) MLPS  -9.35 deficit   2.28 prct   0.00 CutScore  75.96;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GAGCG*UUAAC (   1) MLPS  -9.39 deficit   2.32 prct   0.00 CutScore  75.58;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAC*GAAAC (   1) MLPS  -9.75 deficit   2.68 prct   0.00 CutScore  71.76;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGGAG*UGAGG (   1) MLPS -10.69 deficit   3.62 prct   0.00 CutScore  61.87;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GAACA*UUAGC (   1) MLPS -11.75 deficit   4.68 prct   0.00 CutScore  50.75;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-cWW

Model IL_87904.5 was the best-scoring model for   31 sequences (100.0%) cWW-tSH-tSH-tHS-cWW <-- correct model

Group 206 is from IL_78744.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_78744.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSH-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGGAAG*CGGAAG (   1) MLPS -10.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GGGAAC*GGGAAC (   1) MLPS -10.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tHS-cWW

Model IL_78744.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tSH-tHS-tHS-cWW <-- correct model

Group  96 is from IL_37053.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37053.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSH-tHS-tSS-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGGAAUU*GGAGAUG (   1) MLPS  -9.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-L-R-cWW
Better:   0 Equal:   0 Score 1.00      UGAAAUU*AGAGAUA (   1) MLPS -10.21 deficit   0.40 prct   0.00 CutScore  97.50;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-L-R-cWW
Better:   0 Equal:   0 Score 1.00       UGGAAG*CAGGAAG (   1) MLPS -11.11 deficit   1.30 prct   0.00 CutScore  91.85;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-L-R-cWW

Model IL_37053.1 was the best-scoring model for    3 sequences (100.0%) cWW-tSH-tSH-tHS-tSS-L-R-cWW <-- correct model

Group 139 is from IL_48918.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_48918.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSH-tHS-tSS-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50       GGGAG*CGAAGAAC (   1) MLPS  -8.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-R-cWW
Better:   0 Equal:   1 Score 0.50       GGGAG*CGAAGAAC (   1) MLPS  -8.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-R-cWW
Better:   0 Equal:   0 Score 1.00       GGGAG*CUGUGAAC (   1) MLPS  -9.10 deficit   0.64 prct   0.00 CutScore  96.26;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-R-cWW
Better:   0 Equal:   0 Score 1.00       UGGAG*CGUUGAAA (   1) MLPS  -9.10 deficit   0.65 prct   0.00 CutScore  96.23;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tHS-tSS-R-cWW

Model IL_48918.3 was the best-scoring model for    4 sequences (100.0%) cWW-tSH-tSH-tHS-tSS-R-cWW <-- correct model

Group 241 is from IL_89794.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89794.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tSH-tSS-tSS-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GUAAG*CGUUAUAAC (   1) MLPS -10.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSH-tSS-tSS-R-cWW

Model IL_89794.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tSH-tSS-tSS-R-cWW <-- correct model

Group 121 is from IL_43946.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43946.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSS-tSS-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGAG*CGAGAAAC (   1) MLPS  -4.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSS-tSS-R-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00        GGAG*CGAGAAAC (   1) MLPS  -4.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSS-tSS-R-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00        GGAG*CGCGAAAC (   1) MLPS  -4.66 deficit   0.51 prct   0.00 CutScore  96.78;  Ed  0, 0 matches the original group, cWW-tSH-tSS-tSS-R-R-R-R-cWW

Model IL_43946.1 was the best-scoring model for    3 sequences (100.0%) cWW-tSH-tSS-tSS-R-R-R-R-cWW <-- correct model

Group 202 is from IL_77076.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77076.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSH-tSS-tSS-tWH-tWH-R-R-R-R-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GGAG*CGCCGGUGAAAUAC (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSS-tSS-tWH-tWH-R-R-R-R-R-R-cWW
Better:   0 Equal:   0 Score 1.00  GGAG*CGCCGGUGAAAUAC (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSS-tSS-tWH-tWH-R-R-R-R-R-R-cWW

Model IL_77076.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSH-tSS-tSS-tWH-tWH-R-R-R-R-R-R-cWW <-- correct model

Group 200 is from IL_76486.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76486.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-tSH-tSW-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUUAGUAA*UGAAGCG (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tSW-tHH-cSH-tWH-tHS-cWW

Model IL_76486.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tSW-tHH-cSH-tWH-tHS-cWW <-- correct model

Group 169 is from IL_59934.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59934.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tWH-tHS-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UGUAG*CGUAGAGA (   1) MLPS  -8.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tHS-R-R-cWW

Model IL_59934.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSH-tWH-tHS-R-R-cWW <-- correct model

Group  55 is from IL_22732.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22732.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UUAG*CGAAG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           AUAG*CGAGU (   1) MLPS  -6.86 deficit   0.72 prct   0.00 CutScore  93.48;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CGAG*CGAAG (   1) MLPS  -7.33 deficit   1.20 prct   0.00 CutScore  89.20;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CGAG*UGAAG (   1) MLPS  -7.88 deficit   1.74 prct   0.00 CutScore  84.29;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tHS-cWW

Model IL_22732.1 was the best-scoring model for    4 sequences (100.0%) cWW-tSH-tWH-tHS-cWW <-- correct model

Group 107 is from IL_39585.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39585.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tWH-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UCAAG*CGAAG (   1) MLPS  -9.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*UGAAG (   1) MLPS -10.37 deficit   0.92 prct   0.00 CutScore  92.75;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      UUGAG*CAAGAUGAG (   1) MLPS -12.84 deficit   3.40 prct   0.00 CutScore  73.19;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      UUGAG*CAAGAUGAG (   1) MLPS -12.84 deficit   3.40 prct   0.00 CutScore  73.19;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW
Better:   0 Equal:   1 Score 0.50          CGAUG*CUAAG (   1) MLPS -13.59 deficit   4.14 prct   0.00 CutScore  67.33;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      CUGAC*GGAAAAGAG (   1) MLPS -13.59 deficit   4.14 prct   0.00 CutScore  67.32;  Ed  0, 0 matches the original group, cWW-tSH-tWH-tSH-tHS-cWW

Model IL_39585.1 was the best-scoring model for    6 sequences (100.0%) cWW-tSH-tWH-tSH-tHS-cWW <-- correct model

Group 203 is from IL_77263.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77263.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSS-L-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CAAUGAG*CGAG (   1) MLPS  -4.65 deficit   0.31 prct   0.00 CutScore  98.07;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CAAUGAG*CGAG (   1) MLPS  -4.65 deficit   0.31 prct   0.00 CutScore  98.07;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CGAUGAG*CGAG (   1) MLPS  -5.89 deficit   1.54 prct   0.00 CutScore  90.25;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW

Model IL_77263.2 was the best-scoring model for    6 sequences (100.0%) cWW-tSS-L-tSH-tHS-cWW <-- correct model

Group  94 is from IL_34628.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34628.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-L-tSH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAAUGAUG*UUGAG (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       CAAUGAUG*UUGAG (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       GCGUGAUG*CUGAC (   1) MLPS  -9.80 deficit   4.56 prct   0.00 CutScore  77.18;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tHS-cWW-cWW

Model IL_34628.2 was the best-scoring model for    3 sequences (100.0%) cWW-tSS-L-tSH-tHS-cWW-cWW <-- correct model

Group 178 is from IL_65553.8 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65553.8
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGAUGAAG*UGGAG (   1) MLPS  -7.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAUGAAA*UGGAG (   1) MLPS  -7.71 deficit   0.46 prct   0.00 CutScore  97.32;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGACGAAA*UGGAG (   1) MLPS  -8.19 deficit   0.94 prct   0.00 CutScore  94.51;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   1 Score 0.50       CGAAGAAC*GGGAG (   1) MLPS  -8.31 deficit   1.06 prct   0.00 CutScore  93.78;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAGGAUC*GGGAG (   1) MLPS  -8.59 deficit   1.33 prct   0.00 CutScore  92.17;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUGGAUC*GGGAG (   1) MLPS  -9.10 deficit   1.85 prct   0.00 CutScore  89.17;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGGAGAAG*UGGAG (   1) MLPS  -9.12 deficit   1.87 prct   0.00 CutScore  89.04;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGACGAAG*CAGAG (   1) MLPS  -9.95 deficit   2.69 prct   0.00 CutScore  84.19;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GGAUGAGU*AGGAC (   1) MLPS -10.65 deficit   3.39 prct   0.00 CutScore  80.09;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUGCGAAG*UGGAG (   1) MLPS -10.75 deficit   3.50 prct   0.00 CutScore  79.46;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CAGAGAUG*CGGAG (   1) MLPS -10.78 deficit   3.53 prct   0.00 CutScore  79.30;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGACGAAG*UCGAA (   1) MLPS -10.95 deficit   3.69 prct   0.00 CutScore  78.33;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GAUGGAAG*UGGAC (   1) MLPS -10.95 deficit   3.70 prct   0.00 CutScore  78.32;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CCUAGAAG*UGGAG (   1) MLPS -11.22 deficit   3.97 prct   0.00 CutScore  76.70;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUUUGACU*ACGAG (   1) MLPS -11.49 deficit   4.23 prct   0.00 CutScore  75.17;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAUGACC*GCAAG (   1) MLPS -11.86 deficit   4.61 prct   0.00 CutScore  72.97;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAUGACC*GCAAG (   1) MLPS -11.86 deficit   4.61 prct   0.00 CutScore  72.97;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00      CGUUUGACG*CCGAG (   1) MLPS -13.34 deficit   6.08 prct   0.00 CutScore  64.31;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00      CGACGAUC*GAUUAG (   1) MLPS -15.21 deficit   7.96 prct   0.00 CutScore  53.30;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00      CAGUCACG*UAUCAG (   1) MLPS -15.27 deficit   8.02 prct   0.00 CutScore  52.96;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUUGGAUU*GUCAG (   1) MLPS -16.71 deficit   9.46 prct   0.00 CutScore  44.52;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00      UUUCAACG*UAUCAA (   1) MLPS -17.66 deficit  10.40 prct   0.00 CutScore  38.96;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00    CAAUGACG*UAAGACAG (   1) MLPS -17.79 deficit  10.53 prct   0.00 CutScore  38.21;  Ed  0, 0 matches the original group, cWW-tSS-L-tSH-tSS-tHS-tHS-cWW

Model IL_65553.8 was the best-scoring model for   23 sequences (100.0%) cWW-tSS-L-tSH-tSS-tHS-tHS-cWW <-- correct model

Group 172 is from IL_62499.7 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_62499.7
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-tSS-cSS-L-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAUG*CUAAUC (   1) MLPS  -6.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-cSS-L-R-R-cWW
Better:   0 Equal:   0 Score 1.00          GAAG*CGGACC (   1) MLPS  -7.95 deficit   1.20 prct   0.00 CutScore  91.79;  Ed  0, 0 matches the original group, cWW-tSS-cSS-L-R-R-cWW
Better:   0 Equal:   0 Score 1.00       GUCUAAC*GUAAUC (   1) MLPS -12.07 deficit   5.31 prct   0.00 CutScore  63.50;  Ed  0, 0 matches the original group, cWW-tSS-cSS-L-R-R-cWW

Model IL_62499.7 was the best-scoring model for    3 sequences (100.0%) cWW-tSS-cSS-L-R-R-cWW <-- correct model

Group 142 is from IL_49976.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49976.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSS-cSS-L-cSS-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GUAUUUC*GUAAUC (   1) MLPS  -7.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-cSS-L-cSS-R-L-cWW

Model IL_49976.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSS-cSS-L-cSS-R-L-cWW <-- correct model

Group 242 is from IL_90057.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90057.1
This group is considered to be structured ***************************
Number of NTs: 23  Signature: cWW-tSS-tHH-L-tWW-cSS-tWH-tSW-cWS-cHW-cSS-tWS-cSH-cWH-cHW-cSH-tWH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CACAGUGACGAAGU*AGUGGAACGCG (   1) MLPS  -9.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-tHH-L-tWW-cSS-tWH-tSW-cWS-cHW-cSS-tWS-cSH-cWH-cHW-cSH-tWH-cWW
Better:   0 Equal:   0 Score 1.00 CACAGUGACGAAGU*AGUGGAACGCG (   1) MLPS  -9.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-tHH-L-tWW-cSS-tWH-tSW-cWS-cHW-cSS-tWS-cSH-cWH-cHW-cSH-tWH-cWW

Model IL_90057.1 was the best-scoring model for    2 sequences (100.0%) cWW-tSS-tHH-L-tWW-cSS-tWH-tSW-cWS-cHW-cSS-tWS-cSH-cWH-cHW-cSH-tWH-cWW <-- correct model

Group   3 is from IL_02359.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02359.3
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GAAC*GAGUGAAAAAGAAC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00  GAAC*GAGUGAAAGAGAAC (   1) MLPS  -6.86 deficit   0.51 prct   0.00 CutScore  97.81;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00  GAAC*GAGUGAAAUAGAGC (   1) MLPS  -7.71 deficit   1.36 prct   0.00 CutScore  94.18;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00  GAAC*GAGUGAAAAAGUAC (   1) MLPS  -9.20 deficit   2.85 prct   0.00 CutScore  87.77;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GAAC*GGGCUAAAAGAC (   1) MLPS -11.60 deficit   5.25 prct   0.00 CutScore  77.50;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW

Model IL_02359.3 was the best-scoring model for    5 sequences (100.0%) cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW <-- correct model

Group 104 is from IL_39324.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_39324.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GUACC*GAGGCGAAAUAGAGC (   1) MLPS -10.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW-cWW

Model IL_39324.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSS-tHH-cSW-bif-tSH-tWH-R-R-tHS-cWW-cWW <-- correct model

Group 147 is from IL_52610.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52610.1
This group is considered to be structured ***************************
Number of NTs: 36  Signature: cWW-tSS-tSH-L-L-L-L-cWW-L-L-L-L-L-L-L-L-cSS-L-L-L-cSW-cWW-L-cWW-R-tSH-R-R-R-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GGAGGUUG*CACCCUUCAAAGAGUGCGUAAUAGCUCAC (   1) MLPS -21.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSS-tSH-L-L-L-L-cWW-L-L-L-L-L-L-L-L-cSS-L-L-L-cSW-cWW-L-cWW-R-tSH-R-R-R-R

Model IL_52610.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSS-tSH-L-L-L-L-cWW-L-L-L-L-L-L-L-L-cSS-L-L-L-cSW-cWW-L-cWW-R-tSH-R-R-R-R <-- correct model

Group 247 is from IL_91078.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91078.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSW-L-R-R-L-tWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGCAUAG*CGCAUAG (   1) MLPS  -9.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSW-L-R-R-L-tWS-cWW

Model IL_91078.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSW-L-R-R-L-tWS-cWW <-- correct model

Group 115 is from IL_41791.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41791.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSW-tWH-tSW-cSH-cWS-R-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GCGACCG*CAAAC (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tSW-tWH-tSW-cSH-cWS-R-R-cWW-cWW

Model IL_41791.1 was the best-scoring model for    1 sequences (100.0%) cWW-tSW-tWH-tSW-cSH-cWS-R-R-cWW-cWW <-- correct model

Group 157 is from IL_55649.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_55649.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tWH-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUAU*AAAUG (   1) MLPS  -5.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-L-R-cWW

Model IL_55649.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-L-R-cWW <-- correct model

Group 211 is from IL_80494.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80494.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tWH-L-R-tHS-bif-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CCAACU*ACGAACG (   1) MLPS  -9.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-bif-cWW
Better:   0 Equal:   0 Score 1.00       GCAAAG*CCUAAAC (   1) MLPS  -9.71 deficit   0.58 prct   0.00 CutScore  96.76;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-bif-cWW
Better:   0 Equal:   0 Score 1.00        CAGUCC*GAGAAG (   1) MLPS -12.21 deficit   3.08 prct   0.00 CutScore  82.83;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-bif-cWW

Model IL_80494.2 was the best-scoring model for    3 sequences (100.0%) cWW-tWH-L-R-tHS-bif-cWW <-- correct model

Group 195 is from IL_74876.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74876.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GCAAG*UGAAAC (   1) MLPS  -7.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00         GCAAG*UGAAAC (   1) MLPS  -7.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAA*UGUAA (   1) MLPS -10.26 deficit   3.12 prct   0.00 CutScore  76.61;  Ed  0, 0 matches the original group, cWW-tWH-L-R-tHS-cWW

Model IL_74876.2 was the best-scoring model for    3 sequences (100.0%) cWW-tWH-L-R-tHS-cWW <-- correct model

Group 102 is from IL_38807.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38807.3
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tWH-L-tWW-tHW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UUAAGUG*CUCAAA (   1) MLPS  -5.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-L-tWW-tHW-cSH-cWW
Better:   0 Equal:   0 Score 1.00        UUAAGUG*CUAAA (   1) MLPS  -6.26 deficit   0.37 prct   0.00 CutScore  97.99;  Ed  0, 0 matches the original group, cWW-tWH-L-tWW-tHW-cSH-cWW
Better:   0 Equal:   0 Score 1.00       CUAAGUG*CUUAAG (   1) MLPS  -6.39 deficit   0.51 prct   0.00 CutScore  97.24;  Ed  0, 0 matches the original group, cWW-tWH-L-tWW-tHW-cSH-cWW
Better:   0 Equal:   0 Score 1.00       CUCAGUG*CUCAAG (   1) MLPS  -6.92 deficit   1.04 prct   0.00 CutScore  94.41;  Ed  0, 0 matches the original group, cWW-tWH-L-tWW-tHW-cSH-cWW

Model IL_38807.3 was the best-scoring model for    4 sequences (100.0%) cWW-tWH-L-tWW-tHW-cSH-cWW <-- correct model

Group 221 is from IL_83250.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83250.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tWH-R-R-R-cSH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50         CUGC*GAGGAAG (   1) MLPS  -5.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-R-R-R-cSH-cWW-cWW

Model IL_83250.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-R-R-R-cSH-cWW-cWW <-- correct model

Group  18 is from IL_06468.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06468.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-R-R-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50         CUGC*GAGGAAG (   1) MLPS  -5.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-R-R-R-cWW-cWW

Model IL_06468.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-R-R-R-cWW-cWW <-- correct model

Group 194 is from IL_73276.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73276.5
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-tWH-cSH-L-cWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UCACU*AAA (   1) MLPS  -4.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCACU*ACG (   1) MLPS  -4.73 deficit   0.20 prct   0.00 CutScore  97.87;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00             GCAAU*AC (   1) MLPS  -5.11 deficit   0.58 prct   0.00 CutScore  93.99;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            GCACU*AGC (   1) MLPS  -5.18 deficit   0.65 prct   0.00 CutScore  93.25;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCACU*AUG (   1) MLPS  -5.35 deficit   0.82 prct   0.00 CutScore  91.45;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -5.75 deficit   1.22 prct   0.00 CutScore  87.35;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -5.75 deficit   1.22 prct   0.00 CutScore  87.35;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -5.75 deficit   1.22 prct   0.00 CutScore  87.35;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            GCAAU*AGC (   1) MLPS  -5.77 deficit   1.24 prct   0.00 CutScore  87.14;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00             ACAAU*AU (   1) MLPS  -5.84 deficit   1.31 prct   0.00 CutScore  86.35;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCUCU*ACG (   1) MLPS  -6.28 deficit   1.76 prct   0.00 CutScore  81.78;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCUCU*ACG (   1) MLPS  -6.28 deficit   1.76 prct   0.00 CutScore  81.78;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCUCU*AUG (   1) MLPS  -6.90 deficit   2.37 prct   0.00 CutScore  75.35;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            UCCCU*ACA (   1) MLPS  -6.99 deficit   2.46 prct   0.00 CutScore  74.49;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCAAC*GGG (   1) MLPS  -7.42 deficit   2.89 prct   0.00 CutScore  69.96;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            CCGCU*AUG (   1) MLPS  -7.75 deficit   3.22 prct   0.00 CutScore  66.55;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00           UCCCU*ACCA (   1) MLPS  -9.06 deficit   4.53 prct   0.00 CutScore  52.93;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00          GCGAAU*AAAC (   1) MLPS  -9.09 deficit   4.56 prct   0.00 CutScore  52.69;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00          GCGAAU*AAAC (   1) MLPS  -9.09 deficit   4.56 prct   0.00 CutScore  52.69;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00             CCAGC*GG (   1) MLPS  -9.30 deficit   4.78 prct   0.00 CutScore  50.41;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00            GGAAG*CGC (   1) MLPS -10.82 deficit   6.29 prct   0.00 CutScore  34.73;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW
Better:   0 Equal:   0 Score 1.00             UUAAG*CA (   1) MLPS -11.53 deficit   7.00 prct   0.00 CutScore  27.32;  Ed  0, 0 matches the original group, cWW-tWH-cSH-L-cWS-cWW

Model IL_73276.5 was the best-scoring model for   22 sequences (100.0%) cWW-tWH-cSH-L-cWS-cWW <-- correct model

Group  76 is from IL_28003.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28003.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tWH-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50           CUAAG*UAUG (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   1 Score 0.50           CUAAG*UAUG (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GGAAG*CCC (   1) MLPS  -9.24 deficit   3.27 prct   0.00 CutScore  70.27;  Ed  0, 0 matches the original group, cWW-tWH-cSH-cWW

Model IL_28003.1 was the best-scoring model for    3 sequences (100.0%) cWW-tWH-cSH-cWW <-- correct model

Group  50 is from IL_21254.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21254.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tWH-cWW-tHS-tSS-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAUCAG*CGACGACG (   1) MLPS  -6.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-cWW-tHS-tSS-R-R-cWW

Model IL_21254.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-cWW-tHS-tSS-R-R-cWW <-- correct model

Group 168 is from IL_59529.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59529.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UUAAC*GGAAGA (   1) MLPS  -5.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tHH-tHS-cWW

Model IL_59529.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-tHH-tHS-cWW <-- correct model

Group  60 is from IL_23639.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23639.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tWH-tHS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUAAG*CUAUA (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tHS-L-cWW

Model IL_23639.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-tHS-L-cWW <-- correct model

Group  51 is from IL_21333.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21333.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUAG*CGAAG (   1) MLPS  -6.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           AUAG*CGAAU (   1) MLPS  -6.59 deficit   0.09 prct   0.00 CutScore  99.26;  Ed  0, 0 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CUAU*AAACG (   1) MLPS  -6.84 deficit   0.34 prct   0.00 CutScore  97.12;  Ed  0, 0 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         GUAG*CGAACCC (   1) MLPS  -9.30 deficit   2.80 prct   0.00 CutScore  76.35;  Ed  0, 0 matches the original group, cWW-tWH-tHS-cWW

Model IL_21333.2 was the best-scoring model for    4 sequences (100.0%) cWW-tWH-tHS-cWW <-- correct model

Group  24 is from IL_09333.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09333.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tWH-tWH-tHW-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GACAAC*GCUAAUC (   1) MLPS  -7.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tWH-tHW-tHW-cWW

Model IL_09333.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-tWH-tHW-tHW-cWW <-- correct model

Group 135 is from IL_47687.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47687.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tWH-tWH-tWH-L-R-L-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UACAAAG*CAUAAAG (   1) MLPS  -7.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tWH-tWH-L-R-L-tWW-cWW

Model IL_47687.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWH-tWH-tWH-L-R-L-tWW-cWW <-- correct model

Group 148 is from IL_52940.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52940.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tWH-tWH-tWH-L-R-R-L-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UACAAAG*CAAAAAG (   1) MLPS -12.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWH-tWH-tWH-L-R-R-L-tWW-cWW
Better:   0 Equal:   0 Score 1.00   GCCAGCGA*UUGUGAAAC (   1) MLPS -16.10 deficit   3.54 prct   0.00 CutScore  78.87;  Ed  0, 0 matches the original group, cWW-tWH-tWH-tWH-L-R-R-L-tWW-cWW

Model IL_52940.1 was the best-scoring model for    2 sequences (100.0%) cWW-tWH-tWH-tWH-L-R-R-L-tWW-cWW <-- correct model

Group  92 is from IL_33964.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33964.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-tWW-L-tWH-R-R-R-R-R-R-R-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GGUAAAG*CGAAAAUGAUCGGGGC (   1) MLPS -11.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWW-L-tWH-R-R-R-R-R-R-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00 GGUUAAG*CGAAAAUGAUCGGGGC (   1) MLPS -11.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWW-L-tWH-R-R-R-R-R-R-R-tHH-tHS-cWW

Model IL_33964.1 was the best-scoring model for    2 sequences (100.0%) cWW-tWW-L-tWH-R-R-R-R-R-R-R-tHH-tHS-cWW <-- correct model

Group 188 is from IL_70299.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70299.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWW-L-tWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CUCAUCAG*CUCAAG (   1) MLPS  -8.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWW-L-tWW-L-cWW

Model IL_70299.1 was the best-scoring model for    1 sequences (100.0%) cWW-tWW-L-tWW-L-cWW <-- correct model

Group 229 is from IL_86357.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86357.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   1 Score 0.50              AAG*CCU (   1) MLPS  -3.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   1 Score 0.50              AAG*CCU (   1) MLPS  -3.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              UAG*CCA (   1) MLPS  -3.98 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              GAA*UCC (   1) MLPS  -4.05 deficit   0.13 prct   0.00 CutScore  98.68;  Ed  0, 0 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   1 Score 0.50              CAA*UCG (   1) MLPS  -4.06 deficit   0.13 prct   0.00 CutScore  98.67;  Ed  0, 0 matches the original group, cWW-tWW-cWW

Model IL_86357.3 was the best-scoring model for    5 sequences (100.0%) cWW-tWW-cWW <-- correct model

